Incidental Mutation 'R5625:Tmem50a'
ID441783
Institutional Source Beutler Lab
Gene Symbol Tmem50a
Ensembl Gene ENSMUSG00000028822
Gene Nametransmembrane protein 50A
SynonymsSmp1, CAM, 3200001F09Rik
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5625 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location134897849-134915024 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AACCA to AA at 134898467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030626] [ENSMUST00000030627] [ENSMUST00000105863]
Predicted Effect probably benign
Transcript: ENSMUST00000030626
SMART Domains Protein: ENSMUSP00000030626
Gene: ENSMUSG00000028822

DomainStartEndE-ValueType
Pfam:UPF0220 1 157 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030627
SMART Domains Protein: ENSMUSP00000030627
Gene: ENSMUSG00000028825

DomainStartEndE-ValueType
Pfam:Ammonium_transp 21 400 1.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105863
SMART Domains Protein: ENSMUSP00000101489
Gene: ENSMUSG00000028822

DomainStartEndE-ValueType
Pfam:UPF0220 5 156 2.4e-50 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in the RH gene locus, between the RHD and RHCE genes. The function of its protein product is unknown; however, its sequence has potential transmembrane domains suggesting that it may be an integral membrane protein. Its position between the RH genes suggests that polymorphisms in this gene may be tightly linked to RH haplotypes and may contribute to selective pressure for or against certain RH haplotypes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Tmem50a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Tmem50a APN 4 134898447 missense probably damaging 1.00
IGL01786:Tmem50a APN 4 134898447 missense probably damaging 1.00
IGL01951:Tmem50a APN 4 134898428 utr 3 prime probably benign
R1502:Tmem50a UTSW 4 134909669 missense probably benign 0.00
R1708:Tmem50a UTSW 4 134898468 missense probably benign 0.19
R1935:Tmem50a UTSW 4 134903642 splice site probably benign
R4902:Tmem50a UTSW 4 134909706 missense probably damaging 0.97
Z1176:Tmem50a UTSW 4 134903744 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGTACACATAGGAGCTCTC -3'
(R):5'- TCGAGGAGGGACACTATGTC -3'

Sequencing Primer
(F):5'- CACATAGGAGCTCTCATGATTCTAGC -3'
(R):5'- AGGGACACTATGTCTTACTTGTC -3'
Posted On2016-11-08