Incidental Mutation 'R5625:Otop1'
ID441786
Institutional Source Beutler Lab
Gene Symbol Otop1
Ensembl Gene ENSMUSG00000051596
Gene Nameotopetrin 1
Synonymstlt, A530025J20Rik
MMRRC Submission 043164-MU
Accession Numbers

NCBI RefSeq: NM_172709.3; MGI:2388363

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38275972-38304217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38302761 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 557 (Y557F)
Ref Sequence ENSEMBL: ENSMUSP00000109734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063136] [ENSMUST00000114099]
Predicted Effect probably damaging
Transcript: ENSMUST00000063136
AA Change: Y553F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061805
Gene: ENSMUSG00000051596
AA Change: Y553F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 87 106 N/A INTRINSIC
Pfam:Otopetrin 127 239 1.6e-13 PFAM
Pfam:Otopetrin 240 456 1.9e-16 PFAM
low complexity region 462 471 N/A INTRINSIC
Pfam:Otopetrin 518 583 3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114099
AA Change: Y557F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109734
Gene: ENSMUSG00000051596
AA Change: Y557F

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
Pfam:Otopetrin 130 457 3.1e-40 PFAM
low complexity region 466 475 N/A INTRINSIC
Pfam:Otopetrin 513 587 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187863
Meta Mutation Damage Score 0.3417 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype Strain: 4881519; 2655558; 1856638; 4950042
PHENOTYPE: Homozygous mutant mice display vestibular abnormalities associated with absent otoconia. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(1) Chemically induced(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Otop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Otop1 APN 5 38302845 missense probably damaging 1.00
IGL01793:Otop1 APN 5 38299871 missense possibly damaging 0.89
IGL02071:Otop1 APN 5 38287983 missense probably damaging 1.00
IGL02111:Otop1 APN 5 38277701 missense probably benign 0.01
IGL02660:Otop1 APN 5 38288005 missense probably damaging 0.99
IGL02672:Otop1 APN 5 38277826 critical splice donor site probably null
IGL03164:Otop1 APN 5 38287962 nonsense probably null
BB008:Otop1 UTSW 5 38288020 missense probably damaging 1.00
BB018:Otop1 UTSW 5 38288020 missense probably damaging 1.00
P0015:Otop1 UTSW 5 38294559 splice site probably benign
R0092:Otop1 UTSW 5 38299830 missense probably damaging 0.97
R0639:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0670:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0673:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R2092:Otop1 UTSW 5 38299766 missense probably damaging 1.00
R2105:Otop1 UTSW 5 38300458 missense probably benign
R2152:Otop1 UTSW 5 38302851 missense probably damaging 1.00
R3971:Otop1 UTSW 5 38300189 missense probably benign 0.04
R3972:Otop1 UTSW 5 38300189 missense probably benign 0.04
R4575:Otop1 UTSW 5 38299721 missense probably damaging 1.00
R4660:Otop1 UTSW 5 38300024 missense possibly damaging 0.95
R4998:Otop1 UTSW 5 38294548 critical splice donor site probably null
R5412:Otop1 UTSW 5 38297984 missense probably benign 0.25
R5461:Otop1 UTSW 5 38299715 missense probably damaging 1.00
R5607:Otop1 UTSW 5 38294504 missense possibly damaging 0.68
R5677:Otop1 UTSW 5 38300163 missense probably damaging 1.00
R5792:Otop1 UTSW 5 38297916 missense probably benign 0.04
R5878:Otop1 UTSW 5 38277822 missense possibly damaging 0.73
R6163:Otop1 UTSW 5 38287890 splice site probably null
R7338:Otop1 UTSW 5 38300203 nonsense probably null
R7931:Otop1 UTSW 5 38288020 missense probably damaging 1.00
R7994:Otop1 UTSW 5 38299851 missense probably benign 0.02
R8224:Otop1 UTSW 5 38300503 missense possibly damaging 0.79
X0064:Otop1 UTSW 5 38299751 missense probably damaging 1.00
Z1177:Otop1 UTSW 5 38277770 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACTGATGAAGCTAGTCTCC -3'
(R):5'- ACAGTGTTTGCTCATCCCCG -3'

Sequencing Primer
(F):5'- GATGAAGCTAGTCTCCCCCATG -3'
(R):5'- TGGCTGCAGAACCCCCTTG -3'
Posted On2016-11-08