Incidental Mutation 'R5625:Cyp3a44'
ID441789
Institutional Source Beutler Lab
Gene Symbol Cyp3a44
Ensembl Gene ENSMUSG00000054417
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 44
Synonyms
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145773983-145805874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145779566 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 405 (D405N)
Ref Sequence ENSEMBL: ENSMUSP00000069932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067479]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067479
AA Change: D405N

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069932
Gene: ENSMUSG00000054417
AA Change: D405N

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 2.4e-133 PFAM
Meta Mutation Damage Score 0.3564 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Cyp3a44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Cyp3a44 APN 5 145774347 makesense probably null
IGL00972:Cyp3a44 APN 5 145779724 missense possibly damaging 0.84
IGL01062:Cyp3a44 APN 5 145794339 missense possibly damaging 0.88
IGL01072:Cyp3a44 APN 5 145791628 missense probably benign 0.01
IGL01515:Cyp3a44 APN 5 145799418 nonsense probably null
IGL01738:Cyp3a44 APN 5 145794935 missense probably damaging 1.00
IGL01869:Cyp3a44 APN 5 145790686 missense probably damaging 0.99
IGL02269:Cyp3a44 APN 5 145805737 missense probably benign 0.23
IGL02284:Cyp3a44 APN 5 145788369 missense possibly damaging 0.91
IGL02479:Cyp3a44 APN 5 145790667 missense probably benign 0.01
IGL02480:Cyp3a44 APN 5 145794905 missense possibly damaging 0.93
IGL02506:Cyp3a44 APN 5 145799388 missense probably damaging 1.00
IGL02957:Cyp3a44 APN 5 145779662 nonsense probably null
IGL02978:Cyp3a44 APN 5 145788398 missense probably damaging 0.98
R0427:Cyp3a44 UTSW 5 145779602 missense possibly damaging 0.85
R1240:Cyp3a44 UTSW 5 145774440 missense probably benign 0.02
R1247:Cyp3a44 UTSW 5 145791667 missense probably damaging 1.00
R1657:Cyp3a44 UTSW 5 145779743 missense probably damaging 0.99
R2096:Cyp3a44 UTSW 5 145788405 missense probably damaging 1.00
R2156:Cyp3a44 UTSW 5 145803670 nonsense probably null
R2412:Cyp3a44 UTSW 5 145779579 nonsense probably null
R4817:Cyp3a44 UTSW 5 145803755 missense possibly damaging 0.64
R4884:Cyp3a44 UTSW 5 145777982 missense probably damaging 1.00
R5266:Cyp3a44 UTSW 5 145794397 missense possibly damaging 0.66
R5301:Cyp3a44 UTSW 5 145788516 missense probably damaging 0.99
R5463:Cyp3a44 UTSW 5 145803744 missense probably benign 0.00
R5635:Cyp3a44 UTSW 5 145801314 missense possibly damaging 0.90
R5924:Cyp3a44 UTSW 5 145794327 missense possibly damaging 0.54
R5964:Cyp3a44 UTSW 5 145788467 missense possibly damaging 0.95
R5988:Cyp3a44 UTSW 5 145794918 missense probably damaging 1.00
R6011:Cyp3a44 UTSW 5 145801274 critical splice donor site probably null
R6032:Cyp3a44 UTSW 5 145777946 missense probably damaging 1.00
R6032:Cyp3a44 UTSW 5 145777946 missense probably damaging 1.00
R6413:Cyp3a44 UTSW 5 145794444 missense probably damaging 1.00
R6579:Cyp3a44 UTSW 5 145790706 missense probably damaging 0.99
R6587:Cyp3a44 UTSW 5 145805759 missense probably benign 0.23
R6709:Cyp3a44 UTSW 5 145778092 splice site probably null
R6727:Cyp3a44 UTSW 5 145794971 nonsense probably null
R6825:Cyp3a44 UTSW 5 145779586 missense probably damaging 1.00
R7142:Cyp3a44 UTSW 5 145777961 missense probably benign 0.24
R7352:Cyp3a44 UTSW 5 145803688 missense probably benign 0.01
R7921:Cyp3a44 UTSW 5 145791688 missense probably damaging 1.00
R7962:Cyp3a44 UTSW 5 145801325 missense probably benign
R8099:Cyp3a44 UTSW 5 145788402 missense probably benign 0.12
R8240:Cyp3a44 UTSW 5 145788447 missense probably damaging 0.99
Z1176:Cyp3a44 UTSW 5 145791664 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTAGACTTTCTGCCAGTCGC -3'
(R):5'- CCACCTGTGATACTGTGATGGAG -3'

Sequencing Primer
(F):5'- TCTGCCAGTCGCACCTC -3'
(R):5'- TACTGTGATGGAGATGGAATACCTG -3'
Posted On2016-11-08