Incidental Mutation 'R5625:Brsk1'
ID441793
Institutional Source Beutler Lab
Gene Symbol Brsk1
Ensembl Gene ENSMUSG00000035390
Gene NameBR serine/threonine kinase 1
SynonymsSAD-B, LOC381979
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4690604-4715997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4706400 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 398 (K398E)
Ref Sequence ENSEMBL: ENSMUSP00000039517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048248] [ENSMUST00000086364] [ENSMUST00000120836] [ENSMUST00000205666] [ENSMUST00000206024]
Predicted Effect probably damaging
Transcript: ENSMUST00000048248
AA Change: K398E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039517
Gene: ENSMUSG00000035390
AA Change: K398E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 13 30 N/A INTRINSIC
S_TKc 34 285 6.75e-103 SMART
low complexity region 330 344 N/A INTRINSIC
low complexity region 430 457 N/A INTRINSIC
low complexity region 492 517 N/A INTRINSIC
low complexity region 523 552 N/A INTRINSIC
low complexity region 668 686 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086364
SMART Domains Protein: ENSMUSP00000083550
Gene: ENSMUSG00000046456

DomainStartEndE-ValueType
Pfam:Frag1 4 114 1.5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120836
AA Change: K323E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113448
Gene: ENSMUSG00000035390
AA Change: K323E

DomainStartEndE-ValueType
S_TKc 1 210 1.19e-71 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
low complexity region 448 477 N/A INTRINSIC
low complexity region 593 611 N/A INTRINSIC
low complexity region 671 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123637
Predicted Effect probably benign
Transcript: ENSMUST00000205666
Predicted Effect probably benign
Transcript: ENSMUST00000206024
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutant mice are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Brsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Brsk1 APN 7 4704261 missense probably benign 0.03
IGL01733:Brsk1 APN 7 4706072 missense probably damaging 1.00
IGL03019:Brsk1 APN 7 4710497 intron probably benign
IGL03088:Brsk1 APN 7 4710454 intron probably benign
R0612:Brsk1 UTSW 7 4707426 missense possibly damaging 0.96
R0891:Brsk1 UTSW 7 4704227 missense possibly damaging 0.95
R1455:Brsk1 UTSW 7 4704251 missense probably damaging 1.00
R1728:Brsk1 UTSW 7 4704219 missense probably damaging 1.00
R2884:Brsk1 UTSW 7 4691123 unclassified probably benign
R2939:Brsk1 UTSW 7 4708140 missense possibly damaging 0.53
R4392:Brsk1 UTSW 7 4698750 missense probably damaging 1.00
R4661:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4662:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4756:Brsk1 UTSW 7 4708867 missense possibly damaging 0.72
R4788:Brsk1 UTSW 7 4698955 splice site probably null
R5026:Brsk1 UTSW 7 4704266 missense probably damaging 1.00
R5248:Brsk1 UTSW 7 4708866 missense possibly damaging 0.53
R5267:Brsk1 UTSW 7 4704709 missense probably damaging 1.00
R5419:Brsk1 UTSW 7 4709004 missense possibly damaging 0.53
R5430:Brsk1 UTSW 7 4710436 missense probably benign 0.00
R5659:Brsk1 UTSW 7 4715372 missense possibly damaging 0.93
R6700:Brsk1 UTSW 7 4692701 missense probably damaging 0.99
R6866:Brsk1 UTSW 7 4706407 missense probably damaging 0.98
R7169:Brsk1 UTSW 7 4715404 missense probably benign
R8404:Brsk1 UTSW 7 4706696 missense probably damaging 0.98
Z1088:Brsk1 UTSW 7 4707372 missense possibly damaging 0.96
Z1177:Brsk1 UTSW 7 4704222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTATGAGAGCCTCGC -3'
(R):5'- TCAGAAGGTTCAGGTGTTTCTC -3'

Sequencing Primer
(F):5'- AGCCTCGCTCTGCTATGC -3'
(R):5'- AGAAGGTTCAGGTGTTTCTCCATTTC -3'
Posted On2016-11-08