Incidental Mutation 'R5625:Ampd3'
ID441800
Institutional Source Beutler Lab
Gene Symbol Ampd3
Ensembl Gene ENSMUSG00000005686
Gene Nameadenosine monophosphate deaminase 3
Synonyms
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110768206-110812405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110802523 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 408 (E408A)
Ref Sequence ENSEMBL: ENSMUSP00000130495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005829] [ENSMUST00000170374] [ENSMUST00000213373]
Predicted Effect probably damaging
Transcript: ENSMUST00000005829
AA Change: E408A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005829
Gene: ENSMUSG00000005686
AA Change: E408A

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 1.5e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148367
Predicted Effect probably damaging
Transcript: ENSMUST00000170374
AA Change: E408A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130495
Gene: ENSMUSG00000005686
AA Change: E408A

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 7.6e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195971
Predicted Effect probably damaging
Transcript: ENSMUST00000213373
AA Change: E417A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the adenosine and AMP deaminases family. The encoded protein is an AMP deaminase involved in nucleotide and energy metabolism in erythrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean corpuscular volume, abnormal erythrocyte physiology including increased erythrocyte ATP levels and osmotic fragility after fasting, and increased lung inflammation after hind-limb ischemia andreperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Ampd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Ampd3 APN 7 110803147 missense probably benign 0.01
IGL00576:Ampd3 APN 7 110788821 splice site probably benign
IGL00805:Ampd3 APN 7 110809865 missense possibly damaging 0.78
IGL01486:Ampd3 APN 7 110809916 splice site probably benign
IGL01551:Ampd3 APN 7 110804976 missense probably damaging 1.00
IGL02088:Ampd3 APN 7 110793686 missense probably benign 0.00
IGL02123:Ampd3 APN 7 110802559 missense possibly damaging 0.91
IGL02605:Ampd3 APN 7 110795758 missense probably benign 0.00
IGL02990:Ampd3 APN 7 110807963 splice site probably benign
carson UTSW 7 110800710 missense probably damaging 1.00
commanche UTSW 7 110807871 missense possibly damaging 0.95
guangdong UTSW 7 110803162 missense probably damaging 1.00
penasco UTSW 7 110803226 missense probably damaging 1.00
taos UTSW 7 110804935 missense probably damaging 0.99
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0608:Ampd3 UTSW 7 110795790 missense probably damaging 1.00
R0608:Ampd3 UTSW 7 110795791 missense probably damaging 1.00
R0718:Ampd3 UTSW 7 110777808 missense probably damaging 1.00
R0799:Ampd3 UTSW 7 110800697 missense probably damaging 1.00
R1053:Ampd3 UTSW 7 110788680 missense probably damaging 1.00
R1473:Ampd3 UTSW 7 110804935 missense probably damaging 0.99
R1676:Ampd3 UTSW 7 110795733 missense probably damaging 1.00
R1977:Ampd3 UTSW 7 110803162 missense probably damaging 1.00
R2380:Ampd3 UTSW 7 110800710 missense probably damaging 1.00
R2419:Ampd3 UTSW 7 110768369 unclassified probably benign
R3438:Ampd3 UTSW 7 110803226 missense probably damaging 1.00
R3907:Ampd3 UTSW 7 110793670 missense possibly damaging 0.88
R5367:Ampd3 UTSW 7 110807871 missense possibly damaging 0.95
R6066:Ampd3 UTSW 7 110793767 missense probably benign 0.12
R6267:Ampd3 UTSW 7 110791180 splice site probably null
R6493:Ampd3 UTSW 7 110795811 splice site probably null
R6852:Ampd3 UTSW 7 110802546 missense probably benign 0.02
R7147:Ampd3 UTSW 7 110804852 missense probably damaging 1.00
R7313:Ampd3 UTSW 7 110806054 missense probably damaging 1.00
R7649:Ampd3 UTSW 7 110777842 missense probably benign 0.01
R7843:Ampd3 UTSW 7 110791188 missense probably benign 0.01
R7946:Ampd3 UTSW 7 110777940 missense probably damaging 1.00
R8319:Ampd3 UTSW 7 110795775 missense probably benign 0.01
R8377:Ampd3 UTSW 7 110800730 missense probably damaging 1.00
Z1088:Ampd3 UTSW 7 110777825 missense probably damaging 1.00
Z1177:Ampd3 UTSW 7 110788780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACTACATTTTCCAGCGTGG -3'
(R):5'- CAGGATGCTAGGAGCTCTTC -3'

Sequencing Primer
(F):5'- GGCTGTCTTGGAAAGGCC -3'
(R):5'- ACACTTGTCCATGCTCAAGAG -3'
Posted On2016-11-08