Incidental Mutation 'R5625:Col13a1'
ID441809
Institutional Source Beutler Lab
Gene Symbol Col13a1
Ensembl Gene ENSMUSG00000058806
Gene Namecollagen, type XIII, alpha 1
Synonyms
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61838236-61979108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61843609 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 713 (G713R)
Ref Sequence ENSEMBL: ENSMUSP00000101094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105452] [ENSMUST00000105453] [ENSMUST00000105454]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105451
Predicted Effect unknown
Transcript: ENSMUST00000105452
AA Change: G683R
SMART Domains Protein: ENSMUSP00000101092
Gene: ENSMUSG00000058806
AA Change: G683R

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Pfam:Collagen 154 214 1.6e-12 PFAM
Pfam:Collagen 255 319 1.8e-10 PFAM
Pfam:Collagen 283 338 7.8e-11 PFAM
Pfam:Collagen 313 376 6.8e-10 PFAM
Pfam:Collagen 377 436 3e-10 PFAM
Pfam:Collagen 458 517 4.3e-12 PFAM
Pfam:Collagen 498 559 7.7e-12 PFAM
Pfam:Collagen 557 616 1.6e-11 PFAM
Pfam:Collagen 587 666 9.8e-8 PFAM
Pfam:Collagen 635 704 4e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105453
AA Change: G649R
SMART Domains Protein: ENSMUSP00000101093
Gene: ENSMUSG00000058806
AA Change: G649R

DomainStartEndE-ValueType
internal_repeat_5 17 30 7.25e-5 PROSPERO
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
internal_repeat_5 140 153 7.25e-5 PROSPERO
Pfam:Collagen 154 214 1.5e-12 PFAM
Pfam:Collagen 235 296 1e-10 PFAM
internal_repeat_2 297 328 1.33e-8 PROSPERO
internal_repeat_1 297 332 1.43e-12 PROSPERO
Pfam:Collagen 355 414 2.8e-10 PFAM
Pfam:Collagen 436 495 4.6e-12 PFAM
Pfam:Collagen 477 551 3.6e-8 PFAM
Pfam:Collagen 536 606 5.1e-10 PFAM
Pfam:Collagen 574 670 1.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105454
AA Change: G713R
SMART Domains Protein: ENSMUSP00000101094
Gene: ENSMUSG00000058806
AA Change: G713R

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
Pfam:Collagen 112 161 6.7e-9 PFAM
Pfam:Collagen 164 223 1.5e-11 PFAM
Pfam:Collagen 264 328 6.7e-10 PFAM
Pfam:Collagen 292 347 2.8e-10 PFAM
Pfam:Collagen 322 385 2.3e-9 PFAM
Pfam:Collagen 386 445 1.1e-9 PFAM
Pfam:Collagen 467 526 1.6e-11 PFAM
Pfam:Collagen 507 582 4.8e-9 PFAM
Pfam:Collagen 564 630 5.4e-9 PFAM
low complexity region 671 695 N/A INTRINSIC
internal_repeat_2 698 723 7.38e-7 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000145469
AA Change: G217R
SMART Domains Protein: ENSMUSP00000117248
Gene: ENSMUSG00000058806
AA Change: G217R

DomainStartEndE-ValueType
Pfam:Collagen 8 67 1.1e-12 PFAM
Pfam:Collagen 93 156 7.2e-12 PFAM
Pfam:Collagen 170 239 9.6e-12 PFAM
Meta Mutation Damage Score 0.9555 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the transmembrane exhibit small muscle fibers and are susceptible to excerise-induced muscle damage and muscle inflammation. Mice homozygous for a knock-out allele exhibit tremors and abnormal neuromuscular junction morphology and endplate potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Col13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Col13a1 APN 10 61864005 critical splice acceptor site probably null
IGL00936:Col13a1 APN 10 61876290 missense probably damaging 0.99
IGL00963:Col13a1 APN 10 61838697 utr 3 prime probably benign
IGL01801:Col13a1 APN 10 61843614 missense probably damaging 1.00
IGL02247:Col13a1 APN 10 61961345 missense probably damaging 1.00
IGL02296:Col13a1 APN 10 61862025 intron probably benign
IGL02430:Col13a1 APN 10 61874751 missense probably benign 0.26
IGL02884:Col13a1 APN 10 61905285 splice site probably benign
IGL03036:Col13a1 APN 10 61893913 critical splice donor site probably null
IGL03145:Col13a1 APN 10 61891261 missense probably benign 0.07
IGL03392:Col13a1 APN 10 61885711 missense possibly damaging 0.88
R0027:Col13a1 UTSW 10 61850161 missense unknown
R0440:Col13a1 UTSW 10 61867483 missense possibly damaging 0.85
R0518:Col13a1 UTSW 10 61862746 missense unknown
R0521:Col13a1 UTSW 10 61862746 missense unknown
R0631:Col13a1 UTSW 10 61887350 nonsense probably null
R1311:Col13a1 UTSW 10 61864010 splice site probably benign
R1350:Col13a1 UTSW 10 61894069 splice site probably benign
R1572:Col13a1 UTSW 10 61866426 unclassified probably null
R2401:Col13a1 UTSW 10 61851162 missense unknown
R2883:Col13a1 UTSW 10 61978356 missense probably benign 0.23
R2906:Col13a1 UTSW 10 61860488 intron probably benign
R2964:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R2965:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R3703:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3704:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3844:Col13a1 UTSW 10 61850209 missense unknown
R3928:Col13a1 UTSW 10 61867525 unclassified probably benign
R3939:Col13a1 UTSW 10 61863082 missense unknown
R4327:Col13a1 UTSW 10 61863979 missense unknown
R4328:Col13a1 UTSW 10 61863979 missense unknown
R4329:Col13a1 UTSW 10 61863979 missense unknown
R4585:Col13a1 UTSW 10 61887245 splice site probably null
R4705:Col13a1 UTSW 10 61850165 missense unknown
R4864:Col13a1 UTSW 10 61862660 missense unknown
R5072:Col13a1 UTSW 10 61874018 splice site silent
R5074:Col13a1 UTSW 10 61874018 splice site silent
R5114:Col13a1 UTSW 10 61890101 missense possibly damaging 0.82
R5664:Col13a1 UTSW 10 61851116 missense probably damaging 1.00
R5799:Col13a1 UTSW 10 61849140 intron probably benign
Z1177:Col13a1 UTSW 10 61905262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGCTTGCAGCTGTAGC -3'
(R):5'- TGTGTCCCATAATCCCACGG -3'

Sequencing Primer
(F):5'- TGTAGCTCTGAGGCCCAC -3'
(R):5'- CCCACGGGAATGCTGACTTAATTAAG -3'
Posted On2016-11-08