Incidental Mutation 'R5625:Rhbdf2'
ID441814
Institutional Source Beutler Lab
Gene Symbol Rhbdf2
Ensembl Gene ENSMUSG00000020806
Gene Namerhomboid 5 homolog 2
SynonymsiRhom2, Rhbdl6, 4732465I17Rik
MMRRC Submission 043164-MU
Accession Numbers

VEGA: OTTMUST00000008766; MGI: 2442473

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5625 (G1)
Quality Score179
Status Validated
Chromosome11
Chromosomal Location116598165-116627019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116605377 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 111 (R111C)
Ref Sequence ENSEMBL: ENSMUSP00000099318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103028] [ENSMUST00000103029]
Predicted Effect probably damaging
Transcript: ENSMUST00000103028
AA Change: R111C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806
AA Change: R111C

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103029
AA Change: R111C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806
AA Change: R111C

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138125
Meta Mutation Damage Score 0.3061 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display impaired TNF secretion and increased sensitivity to bacterial infection induced mortality. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted(4) Gene trapped(30)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Rhbdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rhbdf2 APN 11 116601751 missense possibly damaging 0.80
IGL01464:Rhbdf2 APN 11 116600908 missense probably benign 0.18
IGL02060:Rhbdf2 APN 11 116600626 missense probably damaging 1.00
IGL02211:Rhbdf2 APN 11 116600435 missense possibly damaging 0.49
Lostnf UTSW 11 116600161 missense probably damaging 1.00
Lostnf2 UTSW 11 116600191 missense possibly damaging 0.94
sinecure UTSW 11 116602260 missense probably damaging 0.99
Trapezoid UTSW 11 116601148 missense probably damaging 0.96
R0131:Rhbdf2 UTSW 11 116605344 missense probably damaging 1.00
R0399:Rhbdf2 UTSW 11 116603992 missense probably benign 0.00
R0739:Rhbdf2 UTSW 11 116600161 missense probably damaging 1.00
R1756:Rhbdf2 UTSW 11 116607266 missense probably benign
R1839:Rhbdf2 UTSW 11 116600191 missense possibly damaging 0.94
R2029:Rhbdf2 UTSW 11 116601148 missense probably damaging 0.96
R3833:Rhbdf2 UTSW 11 116604424 missense probably damaging 1.00
R4330:Rhbdf2 UTSW 11 116601956 missense probably benign
R4331:Rhbdf2 UTSW 11 116602296 missense probably damaging 1.00
R4872:Rhbdf2 UTSW 11 116601945 missense probably benign 0.04
R5530:Rhbdf2 UTSW 11 116600662 missense probably damaging 1.00
R5841:Rhbdf2 UTSW 11 116602354 unclassified probably benign
R6579:Rhbdf2 UTSW 11 116604463 missense probably benign 0.02
R7047:Rhbdf2 UTSW 11 116603651 critical splice donor site probably null
R7403:Rhbdf2 UTSW 11 116600419 missense probably damaging 1.00
R7743:Rhbdf2 UTSW 11 116601601 missense probably benign 0.04
R7743:Rhbdf2 UTSW 11 116603949 missense probably benign
R7855:Rhbdf2 UTSW 11 116602240 nonsense probably null
R8055:Rhbdf2 UTSW 11 116607365 missense probably benign 0.01
X0027:Rhbdf2 UTSW 11 116599093 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAATGTTGCCCAGACCCTG -3'
(R):5'- CTCGTGTACCCGCAACTCAC -3'

Sequencing Primer
(F):5'- AGACCCTGGGAGAGCCG -3'
(R):5'- GTGTACCCGCAACTCACACATC -3'
Posted On2016-11-08