Incidental Mutation 'R5625:Bmp1'
ID 441817
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 043164-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5625 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70723606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 743 (N743K)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: N743K

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: N743K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Meta Mutation Damage Score 0.2711 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,189,333 (GRCm39) D388A probably benign Het
Ampd3 A C 7: 110,401,730 (GRCm39) E408A probably damaging Het
Brsk1 A G 7: 4,709,399 (GRCm39) K398E probably damaging Het
Ccdc157 A T 11: 4,101,888 (GRCm39) M11K probably damaging Het
Cep295 A C 9: 15,252,187 (GRCm39) M394R probably damaging Het
Cfap44 G T 16: 44,280,710 (GRCm39) probably null Het
Col13a1 C T 10: 61,679,388 (GRCm39) G713R unknown Het
Cxcr2 A T 1: 74,197,991 (GRCm39) K162* probably null Het
Cyp3a44 C T 5: 145,716,376 (GRCm39) D405N possibly damaging Het
Exo1 G T 1: 175,721,380 (GRCm39) D340Y possibly damaging Het
Farp2 T G 1: 93,456,470 (GRCm39) L51R probably damaging Het
Fat4 A T 3: 38,943,083 (GRCm39) I659F possibly damaging Het
Gbp2b T A 3: 142,304,806 (GRCm39) W81R probably damaging Het
Gipc2 C T 3: 151,871,541 (GRCm39) probably benign Het
Gm10941 G T 10: 77,094,670 (GRCm39) probably benign Het
Gm1988 A T 7: 38,823,229 (GRCm39) noncoding transcript Het
Hapln3 G T 7: 78,767,006 (GRCm39) probably null Het
Ifi213 A G 1: 173,396,629 (GRCm39) S482P possibly damaging Het
Insc A G 7: 114,428,302 (GRCm39) T92A probably damaging Het
Lrrn1 T A 6: 107,544,315 (GRCm39) C38S probably damaging Het
Mycbpap T C 11: 94,396,519 (GRCm39) E107G probably damaging Het
Neb A T 2: 52,067,547 (GRCm39) L5848* probably null Het
Nrg3 A T 14: 38,092,950 (GRCm39) M545K probably damaging Het
Nudt3 A G 17: 27,802,202 (GRCm39) L28P probably damaging Het
Or8g35 T A 9: 39,381,099 (GRCm39) M308L probably benign Het
Otop1 A T 5: 38,460,104 (GRCm39) Y557F probably damaging Het
Pcare T A 17: 72,058,321 (GRCm39) D452V probably damaging Het
Pdgfra G A 5: 75,349,998 (GRCm39) probably null Het
Pi4kb A G 3: 94,891,988 (GRCm39) M223V probably benign Het
Piezo1 T C 8: 123,209,699 (GRCm39) T2335A probably benign Het
Ppp6c A G 2: 39,087,453 (GRCm39) V251A probably benign Het
Prkg1 C T 19: 31,742,162 (GRCm39) E21K possibly damaging Het
Ptpru T C 4: 131,530,691 (GRCm39) E521G probably null Het
Rasl10b G T 11: 83,309,640 (GRCm39) R199L probably damaging Het
Rhbdf2 G A 11: 116,496,203 (GRCm39) R111C probably damaging Het
Sec23ip G T 7: 128,346,707 (GRCm39) probably benign Het
Sptbn5 A T 2: 119,910,273 (GRCm39) noncoding transcript Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Syne2 T C 12: 76,141,886 (GRCm39) S6141P probably benign Het
Szt2 A G 4: 118,230,414 (GRCm39) V2653A unknown Het
Tex46 T C 4: 136,337,925 (GRCm39) F39S probably damaging Het
Tmem50a AACCA AA 4: 134,625,778 (GRCm39) probably benign Het
Tmem62 G T 2: 120,820,874 (GRCm39) W180L probably damaging Het
Tnxb G A 17: 34,904,185 (GRCm39) A1232T probably benign Het
Tubgcp3 T C 8: 12,674,888 (GRCm39) H744R possibly damaging Het
Uggt2 A G 14: 119,315,136 (GRCm39) I311T probably damaging Het
Usp8 C T 2: 126,584,197 (GRCm39) R469C probably damaging Het
Vmn1r19 T C 6: 57,382,281 (GRCm39) L278S probably damaging Het
Vmn2r129 A T 4: 156,686,505 (GRCm39) noncoding transcript Het
Vmn2r59 A T 7: 41,695,884 (GRCm39) I176N probably benign Het
Wdr93 A G 7: 79,420,766 (GRCm39) T376A probably benign Het
Zfp575 G A 7: 24,285,077 (GRCm39) A188V possibly damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTCTCCTGATGTGGACCAG -3'
(R):5'- TGAAGCAGTGACCAGAGCTC -3'

Sequencing Primer
(F):5'- ACCTGTGCATGTGACCAG -3'
(R):5'- AGTGACCAGAGCTCCATCGTC -3'
Posted On 2016-11-08