Incidental Mutation 'R5625:Nudt3'
ID441820
Institutional Source Beutler Lab
Gene Symbol Nudt3
Ensembl Gene ENSMUSG00000024213
Gene Namenudix (nucleotide diphosphate linked moiety X)-type motif 3
SynonymsDipp, diphosphoinositol polyphosphate phosphohydrolase, 1110011B09Rik
MMRRC Submission 043164-MU
Accession Numbers

NCBI RefSeq: NM_019837.2; MGI:1928484

Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27579382-27623495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27583228 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 28 (L28P)
Ref Sequence ENSEMBL: ENSMUSP00000156024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025050] [ENSMUST00000062397] [ENSMUST00000114886] [ENSMUST00000156429] [ENSMUST00000176458] [ENSMUST00000176876] [ENSMUST00000231742]
Predicted Effect probably damaging
Transcript: ENSMUST00000025050
AA Change: L80P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025050
Gene: ENSMUSG00000024213
AA Change: L80P

DomainStartEndE-ValueType
Pfam:NUDIX 17 142 3.9e-20 PFAM
low complexity region 153 165 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062397
AA Change: L80P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059061
Gene: ENSMUSG00000024213
AA Change: L80P

DomainStartEndE-ValueType
Pfam:NUDIX 17 135 1.5e-18 PFAM
low complexity region 144 156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114886
AA Change: L51P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110536
Gene: ENSMUSG00000024213
AA Change: L51P

DomainStartEndE-ValueType
Pfam:NUDIX 1 116 1.3e-18 PFAM
low complexity region 124 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133048
Predicted Effect probably damaging
Transcript: ENSMUST00000156429
AA Change: L28P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000176458
SMART Domains Protein: ENSMUSP00000135175
Gene: ENSMUSG00000024213

DomainStartEndE-ValueType
Pfam:NUDIX 1 58 3.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176876
AA Change: L80P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135890
Gene: ENSMUSG00000024213
AA Change: L80P

DomainStartEndE-ValueType
Pfam:NUDIX 17 117 1.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231742
AA Change: L51P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUDT3 belongs to the MutT, or Nudix, protein family. Nudix proteins act as homeostatic checkpoints at important stages in nucleoside phosphate metabolic pathways, guarding against elevated levels of potentially dangerous intermediates, like 8-oxo-dGTP, which promotes AT-to-CG transversions (Safrany et al., 1998 [PubMed 9822604]).[supplied by OMIM, Feb 2011]
Allele List at MGI

All alleles(57) : Targeted(2) Gene trapped(55)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Nudt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Nudt3 UTSW 17 27596715 splice site probably benign
R1136:Nudt3 UTSW 17 27623106 missense probably benign 0.02
R3781:Nudt3 UTSW 17 27580808 missense possibly damaging 0.83
R3782:Nudt3 UTSW 17 27580808 missense possibly damaging 0.83
R7664:Nudt3 UTSW 17 27623175 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCATGGGAAAACAAGCTG -3'
(R):5'- CATGAGCTTACAGACCCGAGTC -3'

Sequencing Primer
(F):5'- TATCTAATGAGCTCCAGGCCAGTG -3'
(R):5'- AGACAGTTGCGAGTCACCTGAC -3'
Posted On2016-11-08