Mutagenetix > Incidental Mutation

Incidental Mutation 'R5626:Ncbp1'

441831

Institutional Source

Beutler Lab

Gene Symbol

Ncbp1

Ensembl Gene

ENSMUSG00000028330

Gene Name

nuclear cap binding protein subunit 1

Synonyms

MMRRC Submission

043165-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5626 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46138613-46172403 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46161290 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 422 (S422N)

Ref Sequence

ENSEMBL: ENSMUSP00000030014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030014] [ENSMUST00000058232]

AlphaFold

Q3UYV9

PDB Structure

Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030014
AA Change: S422N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: S422N

Domain	Start	End	E-Value	Type
MIF4G	28	240	1.33e-38	SMART
Pfam:MIF4G_like	309	471	1.4e-37	PFAM
Pfam:MIF4G_like_2	485	754	4e-78	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000058232

SMART Domains

Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

Domain	Start	End	E-Value	Type
low complexity region	32	55	N/A	INTRINSIC
Pfam:XPA_N	101	132	5.2e-18	PFAM
Pfam:XPA_C	134	185	3e-30	PFAM
low complexity region	212	223	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131187

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133286

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,431,981	Y148H	probably benign	Het
Adh1	G	C	3: 138,280,410	V53L	probably benign	Het
Arfgap2	C	T	2: 91,275,392	Q514*	probably null	Het
Calhm2	A	C	19: 47,133,119	C204G	probably damaging	Het
Carhsp1	T	C	16: 8,661,033	N119D	probably benign	Het
Cfap57	A	G	4: 118,614,783	L133P	probably damaging	Het
Clcn4	A	T	7: 7,289,018	V598E	probably damaging	Het
Cpxm2	TGCAGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAGCAG	7: 132,059,852		probably benign	Het
Ddi1	T	C	9: 6,266,003	H122R	probably benign	Het
Dync1h1	A	G	12: 110,641,141	T2697A	probably benign	Het
Ednrb	T	A	14: 103,843,128	I117F	probably damaging	Het
Egflam	A	G	15: 7,251,207	S446P	possibly damaging	Het
F5	A	G	1: 164,209,035	I1922V	probably damaging	Het
Gpc1	T	A	1: 92,857,119		probably null	Het
Gphn	A	C	12: 78,683,897	I769L	probably benign	Het
Grid2	T	C	6: 64,076,945		probably null	Het
Hira	G	T	16: 18,927,512	Q468H	probably damaging	Het
Hmcn1	C	T	1: 150,656,567	G3154E	probably damaging	Het
Ighv16-1	G	A	12: 114,068,852	T92M	probably damaging	Het
Lcmt2	T	C	2: 121,139,462	E380G	probably benign	Het
Ms4a14	A	G	19: 11,304,055	F380L	probably benign	Het
Myof	T	C	19: 37,922,990	N1511D	probably benign	Het
Pcolce	T	A	5: 137,610,399	T26S	probably damaging	Het
Pitpnm3	T	C	11: 72,112,332	I51V	probably benign	Het
Plcb3	T	C	19: 6,955,275	S1041G	probably benign	Het
Ppp5c	T	C	7: 17,027,704	D37G	probably benign	Het
Prkca	T	C	11: 108,057,815	D116G	possibly damaging	Het
Qrsl1	A	T	10: 43,881,520	D367E	probably benign	Het
Rbm26	T	C	14: 105,144,231	T493A	probably benign	Het
Saxo1	T	C	4: 86,445,589	E219G	probably damaging	Het
Slc22a16	A	T	10: 40,584,853		probably null	Het
Tmem30c	T	C	16: 57,276,143	N205S	possibly damaging	Het
Trp53i11	A	G	2: 93,199,378	N119S	possibly damaging	Het
Wnt3a	A	T	11: 59,290,583	I22N	probably benign	Het

Other mutations in Ncbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00840:Ncbp1	APN	4	46161307	missense	probably damaging	1.00
IGL02085:Ncbp1	APN	4	46159699	missense	probably damaging	0.96
IGL02230:Ncbp1	APN	4	46165272	missense	probably benign	0.03
IGL02561:Ncbp1	APN	4	46159711	missense	possibly damaging	0.80
IGL02574:Ncbp1	APN	4	46168449	critical splice acceptor site	probably null
IGL03371:Ncbp1	APN	4	46171991	nonsense	probably null
R0549:Ncbp1	UTSW	4	46168476	missense	possibly damaging	0.69
R0594:Ncbp1	UTSW	4	46170551	missense	probably benign	0.00
R0699:Ncbp1	UTSW	4	46147528	missense	probably benign	0.17
R0725:Ncbp1	UTSW	4	46152056	missense	probably benign	0.01
R0961:Ncbp1	UTSW	4	46165193	missense	possibly damaging	0.69
R1330:Ncbp1	UTSW	4	46167354	missense	probably benign	0.19
R1622:Ncbp1	UTSW	4	46171963	missense	possibly damaging	0.60
R1756:Ncbp1	UTSW	4	46169131	nonsense	probably null
R2417:Ncbp1	UTSW	4	46168530	missense	probably benign	0.20
R4050:Ncbp1	UTSW	4	46147483	missense	probably damaging	0.99
R4132:Ncbp1	UTSW	4	46169241	nonsense	probably null
R4516:Ncbp1	UTSW	4	46157824	missense	probably damaging	1.00
R4795:Ncbp1	UTSW	4	46152967	missense	possibly damaging	0.83
R4796:Ncbp1	UTSW	4	46152967	missense	possibly damaging	0.83
R4960:Ncbp1	UTSW	4	46165273	nonsense	probably null
R5557:Ncbp1	UTSW	4	46165259	missense	probably benign	0.01
R5682:Ncbp1	UTSW	4	46170474	unclassified	probably benign
R5859:Ncbp1	UTSW	4	46163026	missense	probably benign	0.00
R6377:Ncbp1	UTSW	4	46150703	missense	probably damaging	1.00
R6440:Ncbp1	UTSW	4	46147516	missense	probably damaging	1.00
R6793:Ncbp1	UTSW	4	46157827	missense	probably damaging	0.99
R7078:Ncbp1	UTSW	4	46155756	missense	probably benign	0.00
R7434:Ncbp1	UTSW	4	46149910	missense	probably damaging	1.00
R7445:Ncbp1	UTSW	4	46149914	missense	probably damaging	0.98
R7477:Ncbp1	UTSW	4	46157897	missense	probably damaging	1.00
R7670:Ncbp1	UTSW	4	46170015	missense	probably damaging	0.96
R8424:Ncbp1	UTSW	4	46144839	missense	probably benign
R8970:Ncbp1	UTSW	4	46170023	missense	probably damaging	0.99
R9712:Ncbp1	UTSW	4	46144837	missense	probably benign	0.03
X0013:Ncbp1	UTSW	4	46150702	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GTCAGAGGCTTTGCTGAGAAAAC -3'
(R):5'- ACATGACCGTGACATGCAC -3'

Sequencing Primer
(F):5'- GCTTTGCTGAGAAAACAGTTAAAG -3'
(R):5'- ATATCTGGGATTAGAACCCGCGTC -3'

Posted On

2016-11-08