Mutagenetix > Incidental Mutation

Incidental Mutation 'R5626:Grid2'

441835

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

tpr, B230104L07Rik, GluRdelta2

MMRRC Submission

043165-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5626 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63232860-64681307 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 64053929 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852] [ENSMUST00000095852] [ENSMUST00000095852] [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

probably null
Transcript: ENSMUST00000095852

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000095852

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000095852

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000095852

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159561

SMART Domains

Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	2.7e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161105

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162968

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adh1	G	C	3: 137,986,171 (GRCm39)	V53L	probably benign	Het
Arfgap2	C	T	2: 91,105,737 (GRCm39)	Q514*	probably null	Het
Calhm2	A	C	19: 47,121,558 (GRCm39)	C204G	probably damaging	Het
Carhsp1	T	C	16: 8,478,897 (GRCm39)	N119D	probably benign	Het
Cfap57	A	G	4: 118,471,980 (GRCm39)	L133P	probably damaging	Het
Clcn4	A	T	7: 7,292,017 (GRCm39)	V598E	probably damaging	Het
Cpxm2	TGCAGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAGCAG	7: 131,661,581 (GRCm39)		probably benign	Het
Ddi1	T	C	9: 6,266,003 (GRCm39)	H122R	probably benign	Het
Dync1h1	A	G	12: 110,607,575 (GRCm39)	T2697A	probably benign	Het
Ednrb	T	A	14: 104,080,564 (GRCm39)	I117F	probably damaging	Het
Egflam	A	G	15: 7,280,688 (GRCm39)	S446P	possibly damaging	Het
F5	A	G	1: 164,036,604 (GRCm39)	I1922V	probably damaging	Het
Gpc1	T	A	1: 92,784,841 (GRCm39)		probably null	Het
Gphn	A	C	12: 78,730,671 (GRCm39)	I769L	probably benign	Het
Hira	G	T	16: 18,746,262 (GRCm39)	Q468H	probably damaging	Het
Hmcn1	C	T	1: 150,532,318 (GRCm39)	G3154E	probably damaging	Het
Ighv16-1	G	A	12: 114,032,472 (GRCm39)	T92M	probably damaging	Het
Lcmt2	T	C	2: 120,969,943 (GRCm39)	E380G	probably benign	Het
Ms4a14	A	G	19: 11,281,419 (GRCm39)	F380L	probably benign	Het
Myof	T	C	19: 37,911,438 (GRCm39)	N1511D	probably benign	Het
Ncbp1	G	A	4: 46,161,290 (GRCm39)	S422N	probably damaging	Het
Pcolce	T	A	5: 137,608,661 (GRCm39)	T26S	probably damaging	Het
Pitpnm3	T	C	11: 72,003,158 (GRCm39)	I51V	probably benign	Het
Plcb3	T	C	19: 6,932,643 (GRCm39)	S1041G	probably benign	Het
Ppp5c	T	C	7: 16,761,629 (GRCm39)	D37G	probably benign	Het
Prkca	T	C	11: 107,948,641 (GRCm39)	D116G	possibly damaging	Het
Qrsl1	A	T	10: 43,757,516 (GRCm39)	D367E	probably benign	Het
Rbm26	T	C	14: 105,381,667 (GRCm39)	T493A	probably benign	Het
Saxo1	T	C	4: 86,363,826 (GRCm39)	E219G	probably damaging	Het
Slc22a16	A	T	10: 40,460,849 (GRCm39)		probably null	Het
Tmem30c	T	C	16: 57,096,506 (GRCm39)	N205S	possibly damaging	Het
Trp53i11	A	G	2: 93,029,723 (GRCm39)	N119S	possibly damaging	Het
Wnt3a	A	T	11: 59,181,409 (GRCm39)	I22N	probably benign	Het
Zfp998	A	G	13: 66,580,040 (GRCm39)	Y148H	probably benign	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64,322,573 (GRCm39)	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64,510,688 (GRCm39)	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64,297,180 (GRCm39)	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64,642,899 (GRCm39)	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64,040,919 (GRCm39)	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64,322,650 (GRCm39)	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64,322,857 (GRCm39)	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64,322,800 (GRCm39)	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64,040,888 (GRCm39)	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64,406,806 (GRCm39)	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63,886,053 (GRCm39)	missense	possibly damaging	0.94
crawler	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
swagger	UTSW	6	64,372,263 (GRCm39)	synonymous	probably benign
R0133:Grid2	UTSW	6	64,297,116 (GRCm39)	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64,510,571 (GRCm39)	missense	probably benign
R0193:Grid2	UTSW	6	64,040,937 (GRCm39)	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64,322,718 (GRCm39)	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64,643,036 (GRCm39)	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63,480,419 (GRCm39)	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64,643,259 (GRCm39)	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64,406,738 (GRCm39)	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64,406,668 (GRCm39)	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
R1762:Grid2	UTSW	6	64,510,638 (GRCm39)	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63,886,045 (GRCm39)	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63,885,877 (GRCm39)	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63,885,902 (GRCm39)	nonsense	probably null
R2138:Grid2	UTSW	6	64,322,782 (GRCm39)	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63,480,383 (GRCm39)	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64,297,005 (GRCm39)	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64,322,826 (GRCm39)	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63,480,417 (GRCm39)	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63,886,029 (GRCm39)	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64,297,086 (GRCm39)	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64,642,899 (GRCm39)	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64,643,185 (GRCm39)	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63,885,972 (GRCm39)	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64,406,724 (GRCm39)	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64,297,136 (GRCm39)	nonsense	probably null
R5091:Grid2	UTSW	6	64,053,862 (GRCm39)	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64,642,982 (GRCm39)	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63,908,089 (GRCm39)	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63,907,894 (GRCm39)	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63,480,345 (GRCm39)	missense	probably benign
R5699:Grid2	UTSW	6	63,885,975 (GRCm39)	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64,071,416 (GRCm39)	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64,640,146 (GRCm39)	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64,322,577 (GRCm39)	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63,907,999 (GRCm39)	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64,372,283 (GRCm39)	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64,053,893 (GRCm39)	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64,677,402 (GRCm39)	missense	unknown
R7126:Grid2	UTSW	6	64,053,794 (GRCm39)	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64,252,854 (GRCm39)	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64,053,925 (GRCm39)	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63,908,085 (GRCm39)	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64,297,120 (GRCm39)	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63,885,891 (GRCm39)	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63,233,929 (GRCm39)	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64,510,635 (GRCm39)	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63,480,321 (GRCm39)	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63,233,923 (GRCm39)	missense	probably benign
R8965:Grid2	UTSW	6	64,296,990 (GRCm39)	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64,643,139 (GRCm39)	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63,885,888 (GRCm39)	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64,677,506 (GRCm39)	missense	unknown
R9653:Grid2	UTSW	6	63,907,968 (GRCm39)	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	64,640,212 (GRCm39)	missense	probably benign	0.03
Z1176:Grid2	UTSW	6	63,885,863 (GRCm39)	missense	possibly damaging	0.76
Z1177:Grid2	UTSW	6	64,322,841 (GRCm39)	missense	probably damaging	1.00
Z1177:Grid2	UTSW	6	64,322,840 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGCCTAATGACTCCTGTC -3'
(R):5'- AGCAATTTAGATTTCACACCCTCC -3'

Sequencing Primer
(F):5'- GGGCCTAATGACTCCTGTCTACTTTC -3'
(R):5'- AATTTAGATTTCACACCCTCCAGTTC -3'

Posted On

2016-11-08