Incidental Mutation 'R5626:Slc22a16'
ID441841
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
MMRRC Submission 043165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5626 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 40584853 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect probably null
Transcript: ENSMUST00000019978
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078314
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,431,981 Y148H probably benign Het
Adh1 G C 3: 138,280,410 V53L probably benign Het
Arfgap2 C T 2: 91,275,392 Q514* probably null Het
Calhm2 A C 19: 47,133,119 C204G probably damaging Het
Carhsp1 T C 16: 8,661,033 N119D probably benign Het
Cfap57 A G 4: 118,614,783 L133P probably damaging Het
Clcn4 A T 7: 7,289,018 V598E probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Ddi1 T C 9: 6,266,003 H122R probably benign Het
Dync1h1 A G 12: 110,641,141 T2697A probably benign Het
Ednrb T A 14: 103,843,128 I117F probably damaging Het
Egflam A G 15: 7,251,207 S446P possibly damaging Het
F5 A G 1: 164,209,035 I1922V probably damaging Het
Gpc1 T A 1: 92,857,119 probably null Het
Gphn A C 12: 78,683,897 I769L probably benign Het
Grid2 T C 6: 64,076,945 probably null Het
Hira G T 16: 18,927,512 Q468H probably damaging Het
Hmcn1 C T 1: 150,656,567 G3154E probably damaging Het
Ighv16-1 G A 12: 114,068,852 T92M probably damaging Het
Lcmt2 T C 2: 121,139,462 E380G probably benign Het
Ms4a14 A G 19: 11,304,055 F380L probably benign Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Ncbp1 G A 4: 46,161,290 S422N probably damaging Het
Pcolce T A 5: 137,610,399 T26S probably damaging Het
Pitpnm3 T C 11: 72,112,332 I51V probably benign Het
Plcb3 T C 19: 6,955,275 S1041G probably benign Het
Ppp5c T C 7: 17,027,704 D37G probably benign Het
Prkca T C 11: 108,057,815 D116G possibly damaging Het
Qrsl1 A T 10: 43,881,520 D367E probably benign Het
Rbm26 T C 14: 105,144,231 T493A probably benign Het
Saxo1 T C 4: 86,445,589 E219G probably damaging Het
Tmem30c T C 16: 57,276,143 N205S possibly damaging Het
Trp53i11 A G 2: 93,199,378 N119S possibly damaging Het
Wnt3a A T 11: 59,290,583 I22N probably benign Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
R7685:Slc22a16 UTSW 10 40574089 missense possibly damaging 0.73
R7883:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
R7966:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
RF004:Slc22a16 UTSW 10 40603646 missense possibly damaging 0.94
Z1177:Slc22a16 UTSW 10 40585156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTCAGAAGAAACTGACAATATCCC -3'
(R):5'- GATCTGATAGAGCCACCACG -3'

Sequencing Primer
(F):5'- CTGTAGCTTGCAACTCAG -3'
(R):5'- GATCTGATAGAGCCACCACGTTTTC -3'
Posted On2016-11-08