Incidental Mutation 'R5626:2410141K09Rik'
Institutional Source Beutler Lab
Gene Symbol 2410141K09Rik
Ensembl Gene ENSMUSG00000074832
Gene NameRIKEN cDNA 2410141K09 gene
SynonymsGt(Ayu21)35Imeg, Gt(pU21)35Imeg
MMRRC Submission 043165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5626 (G1)
Quality Score109
Status Not validated
Chromosomal Location66418114-66441118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66431981 bp
Amino Acid Change Tyrosine to Histidine at position 148 (Y148H)
Ref Sequence ENSEMBL: ENSMUSP00000134352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091541] [ENSMUST00000172579] [ENSMUST00000173583]
Predicted Effect probably benign
Transcript: ENSMUST00000091541
SMART Domains Protein: ENSMUSP00000089126
Gene: ENSMUSG00000074832

KRAB 4 66 6.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172579
AA Change: Y148H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134352
Gene: ENSMUSG00000074832
AA Change: Y148H

KRAB 4 66 3.3e-15 SMART
ZnF_C2H2 75 97 1.72e-4 SMART
ZnF_C2H2 103 125 1.06e-4 SMART
ZnF_C2H2 131 153 5.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173583
SMART Domains Protein: ENSMUSP00000134048
Gene: ENSMUSG00000074832

KRAB 4 66 6.16e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225647
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 G C 3: 138,280,410 V53L probably benign Het
Arfgap2 C T 2: 91,275,392 Q514* probably null Het
Calhm2 A C 19: 47,133,119 C204G probably damaging Het
Carhsp1 T C 16: 8,661,033 N119D probably benign Het
Cfap57 A G 4: 118,614,783 L133P probably damaging Het
Clcn4 A T 7: 7,289,018 V598E probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Ddi1 T C 9: 6,266,003 H122R probably benign Het
Dync1h1 A G 12: 110,641,141 T2697A probably benign Het
Ednrb T A 14: 103,843,128 I117F probably damaging Het
Egflam A G 15: 7,251,207 S446P possibly damaging Het
F5 A G 1: 164,209,035 I1922V probably damaging Het
Gpc1 T A 1: 92,857,119 probably null Het
Gphn A C 12: 78,683,897 I769L probably benign Het
Grid2 T C 6: 64,076,945 probably null Het
Hira G T 16: 18,927,512 Q468H probably damaging Het
Hmcn1 C T 1: 150,656,567 G3154E probably damaging Het
Ighv16-1 G A 12: 114,068,852 T92M probably damaging Het
Lcmt2 T C 2: 121,139,462 E380G probably benign Het
Ms4a14 A G 19: 11,304,055 F380L probably benign Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Ncbp1 G A 4: 46,161,290 S422N probably damaging Het
Pcolce T A 5: 137,610,399 T26S probably damaging Het
Pitpnm3 T C 11: 72,112,332 I51V probably benign Het
Plcb3 T C 19: 6,955,275 S1041G probably benign Het
Ppp5c T C 7: 17,027,704 D37G probably benign Het
Prkca T C 11: 108,057,815 D116G possibly damaging Het
Qrsl1 A T 10: 43,881,520 D367E probably benign Het
Rbm26 T C 14: 105,144,231 T493A probably benign Het
Saxo1 T C 4: 86,445,589 E219G probably damaging Het
Slc22a16 A T 10: 40,584,853 probably null Het
Tmem30c T C 16: 57,276,143 N205S possibly damaging Het
Trp53i11 A G 2: 93,199,378 N119S possibly damaging Het
Wnt3a A T 11: 59,290,583 I22N probably benign Het
Other mutations in 2410141K09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2698:2410141K09Rik UTSW 13 66433434 missense probably damaging 0.99
R2881:2410141K09Rik UTSW 13 66431270 missense probably damaging 1.00
R5217:2410141K09Rik UTSW 13 66433726 missense probably damaging 1.00
R5401:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R5429:2410141K09Rik UTSW 13 66431828 missense probably benign 0.00
R5532:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R5686:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R6151:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R6173:2410141K09Rik UTSW 13 66431549 missense probably benign 0.00
R6857:2410141K09Rik UTSW 13 66432102 missense probably benign
R7405:2410141K09Rik UTSW 13 66431059 missense unknown
R7737:2410141K09Rik UTSW 13 66433677 critical splice donor site probably null
R8482:2410141K09Rik UTSW 13 66431738 intron probably benign
Z1088:2410141K09Rik UTSW 13 66431186 missense probably damaging 1.00
Z1088:2410141K09Rik UTSW 13 66431741 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-11-08