Incidental Mutation 'R5626:Ednrb'
ID 441850
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 043165-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R5626 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104080564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 117 (I117F)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: I117F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: I117F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: I117F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: I117F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: I117F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 G C 3: 137,986,171 (GRCm39) V53L probably benign Het
Arfgap2 C T 2: 91,105,737 (GRCm39) Q514* probably null Het
Calhm2 A C 19: 47,121,558 (GRCm39) C204G probably damaging Het
Carhsp1 T C 16: 8,478,897 (GRCm39) N119D probably benign Het
Cfap57 A G 4: 118,471,980 (GRCm39) L133P probably damaging Het
Clcn4 A T 7: 7,292,017 (GRCm39) V598E probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 131,661,581 (GRCm39) probably benign Het
Ddi1 T C 9: 6,266,003 (GRCm39) H122R probably benign Het
Dync1h1 A G 12: 110,607,575 (GRCm39) T2697A probably benign Het
Egflam A G 15: 7,280,688 (GRCm39) S446P possibly damaging Het
F5 A G 1: 164,036,604 (GRCm39) I1922V probably damaging Het
Gpc1 T A 1: 92,784,841 (GRCm39) probably null Het
Gphn A C 12: 78,730,671 (GRCm39) I769L probably benign Het
Grid2 T C 6: 64,053,929 (GRCm39) probably null Het
Hira G T 16: 18,746,262 (GRCm39) Q468H probably damaging Het
Hmcn1 C T 1: 150,532,318 (GRCm39) G3154E probably damaging Het
Ighv16-1 G A 12: 114,032,472 (GRCm39) T92M probably damaging Het
Lcmt2 T C 2: 120,969,943 (GRCm39) E380G probably benign Het
Ms4a14 A G 19: 11,281,419 (GRCm39) F380L probably benign Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Ncbp1 G A 4: 46,161,290 (GRCm39) S422N probably damaging Het
Pcolce T A 5: 137,608,661 (GRCm39) T26S probably damaging Het
Pitpnm3 T C 11: 72,003,158 (GRCm39) I51V probably benign Het
Plcb3 T C 19: 6,932,643 (GRCm39) S1041G probably benign Het
Ppp5c T C 7: 16,761,629 (GRCm39) D37G probably benign Het
Prkca T C 11: 107,948,641 (GRCm39) D116G possibly damaging Het
Qrsl1 A T 10: 43,757,516 (GRCm39) D367E probably benign Het
Rbm26 T C 14: 105,381,667 (GRCm39) T493A probably benign Het
Saxo1 T C 4: 86,363,826 (GRCm39) E219G probably damaging Het
Slc22a16 A T 10: 40,460,849 (GRCm39) probably null Het
Tmem30c T C 16: 57,096,506 (GRCm39) N205S possibly damaging Het
Trp53i11 A G 2: 93,029,723 (GRCm39) N119S possibly damaging Het
Wnt3a A T 11: 59,181,409 (GRCm39) I22N probably benign Het
Zfp998 A G 13: 66,580,040 (GRCm39) Y148H probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGATTGCCACTTTACCACTCAG -3'
(R):5'- ACCAGAGGTTCCAACTCCAG -3'

Sequencing Primer
(F):5'- AGCTTACAACCCCACCTTTGG -3'
(R):5'- AGAGGTTCCAACTCCAGTCTGATG -3'
Posted On 2016-11-08