Incidental Mutation 'R5626:Carhsp1'
ID441854
Institutional Source Beutler Lab
Gene Symbol Carhsp1
Ensembl Gene ENSMUSG00000008393
Gene Namecalcium regulated heat stable protein 1
SynonymsD16Ertd465e, 1200011K09Rik
MMRRC Submission 043165-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R5626 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location8658580-8672155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8661033 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 119 (N119D)
Ref Sequence ENSEMBL: ENSMUSP00000008537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008537] [ENSMUST00000023396] [ENSMUST00000230828]
Predicted Effect probably benign
Transcript: ENSMUST00000008537
AA Change: N119D

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000008537
Gene: ENSMUSG00000008393
AA Change: N119D

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
CSP 65 130 1.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023396
SMART Domains Protein: ENSMUSP00000023396
Gene: ENSMUSG00000022711

DomainStartEndE-ValueType
Pfam:Hydrolase_3 5 229 1.6e-11 PFAM
Pfam:PMM 24 242 6.7e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131385
Predicted Effect probably benign
Transcript: ENSMUST00000230828
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,431,981 Y148H probably benign Het
Adh1 G C 3: 138,280,410 V53L probably benign Het
Arfgap2 C T 2: 91,275,392 Q514* probably null Het
Calhm2 A C 19: 47,133,119 C204G probably damaging Het
Cfap57 A G 4: 118,614,783 L133P probably damaging Het
Clcn4 A T 7: 7,289,018 V598E probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Ddi1 T C 9: 6,266,003 H122R probably benign Het
Dync1h1 A G 12: 110,641,141 T2697A probably benign Het
Ednrb T A 14: 103,843,128 I117F probably damaging Het
Egflam A G 15: 7,251,207 S446P possibly damaging Het
F5 A G 1: 164,209,035 I1922V probably damaging Het
Gpc1 T A 1: 92,857,119 probably null Het
Gphn A C 12: 78,683,897 I769L probably benign Het
Grid2 T C 6: 64,076,945 probably null Het
Hira G T 16: 18,927,512 Q468H probably damaging Het
Hmcn1 C T 1: 150,656,567 G3154E probably damaging Het
Ighv16-1 G A 12: 114,068,852 T92M probably damaging Het
Lcmt2 T C 2: 121,139,462 E380G probably benign Het
Ms4a14 A G 19: 11,304,055 F380L probably benign Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Ncbp1 G A 4: 46,161,290 S422N probably damaging Het
Pcolce T A 5: 137,610,399 T26S probably damaging Het
Pitpnm3 T C 11: 72,112,332 I51V probably benign Het
Plcb3 T C 19: 6,955,275 S1041G probably benign Het
Ppp5c T C 7: 17,027,704 D37G probably benign Het
Prkca T C 11: 108,057,815 D116G possibly damaging Het
Qrsl1 A T 10: 43,881,520 D367E probably benign Het
Rbm26 T C 14: 105,144,231 T493A probably benign Het
Saxo1 T C 4: 86,445,589 E219G probably damaging Het
Slc22a16 A T 10: 40,584,853 probably null Het
Tmem30c T C 16: 57,276,143 N205S possibly damaging Het
Trp53i11 A G 2: 93,199,378 N119S possibly damaging Het
Wnt3a A T 11: 59,290,583 I22N probably benign Het
Other mutations in Carhsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Carhsp1 APN 16 8663713 unclassified probably benign
R4659:Carhsp1 UTSW 16 8664265 missense probably benign 0.18
R4903:Carhsp1 UTSW 16 8661000 missense probably damaging 0.98
R5443:Carhsp1 UTSW 16 8664339 missense probably benign 0.00
R7014:Carhsp1 UTSW 16 8661005 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AATGTTCTATCCAGGATGGCC -3'
(R):5'- GGAGCAAATGCCATGATTCC -3'

Sequencing Primer
(F):5'- AGGATGGCCCTGCTCCTC -3'
(R):5'- TCACTGAACATGGCTAGCTG -3'
Posted On2016-11-08