Incidental Mutation 'R5626:Tmem30c'
Institutional Source Beutler Lab
Gene Symbol Tmem30c
Ensembl Gene ENSMUSG00000022753
Gene Nametransmembrane protein 30C
Synonyms4933409A18Rik, 4933401B01Rik
MMRRC Submission 043165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5626 (G1)
Quality Score225
Status Not validated
Chromosomal Location57266139-57292865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57276143 bp
Amino Acid Change Asparagine to Serine at position 205 (N205S)
Ref Sequence ENSEMBL: ENSMUSP00000113896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023434] [ENSMUST00000119407] [ENSMUST00000120112]
Predicted Effect probably benign
Transcript: ENSMUST00000023434
AA Change: N205S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023434
Gene: ENSMUSG00000022753
AA Change: N205S

Pfam:CDC50 54 339 2.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119407
AA Change: N205S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112989
Gene: ENSMUSG00000022753
AA Change: N205S

Pfam:CDC50 53 340 2.6e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120112
AA Change: N205S

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113896
Gene: ENSMUSG00000022753
AA Change: N205S

Pfam:CDC50 53 283 9.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180871
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,431,981 Y148H probably benign Het
Adh1 G C 3: 138,280,410 V53L probably benign Het
Arfgap2 C T 2: 91,275,392 Q514* probably null Het
Calhm2 A C 19: 47,133,119 C204G probably damaging Het
Carhsp1 T C 16: 8,661,033 N119D probably benign Het
Cfap57 A G 4: 118,614,783 L133P probably damaging Het
Clcn4 A T 7: 7,289,018 V598E probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Ddi1 T C 9: 6,266,003 H122R probably benign Het
Dync1h1 A G 12: 110,641,141 T2697A probably benign Het
Ednrb T A 14: 103,843,128 I117F probably damaging Het
Egflam A G 15: 7,251,207 S446P possibly damaging Het
F5 A G 1: 164,209,035 I1922V probably damaging Het
Gpc1 T A 1: 92,857,119 probably null Het
Gphn A C 12: 78,683,897 I769L probably benign Het
Grid2 T C 6: 64,076,945 probably null Het
Hira G T 16: 18,927,512 Q468H probably damaging Het
Hmcn1 C T 1: 150,656,567 G3154E probably damaging Het
Ighv16-1 G A 12: 114,068,852 T92M probably damaging Het
Lcmt2 T C 2: 121,139,462 E380G probably benign Het
Ms4a14 A G 19: 11,304,055 F380L probably benign Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Ncbp1 G A 4: 46,161,290 S422N probably damaging Het
Pcolce T A 5: 137,610,399 T26S probably damaging Het
Pitpnm3 T C 11: 72,112,332 I51V probably benign Het
Plcb3 T C 19: 6,955,275 S1041G probably benign Het
Ppp5c T C 7: 17,027,704 D37G probably benign Het
Prkca T C 11: 108,057,815 D116G possibly damaging Het
Qrsl1 A T 10: 43,881,520 D367E probably benign Het
Rbm26 T C 14: 105,144,231 T493A probably benign Het
Saxo1 T C 4: 86,445,589 E219G probably damaging Het
Slc22a16 A T 10: 40,584,853 probably null Het
Trp53i11 A G 2: 93,199,378 N119S possibly damaging Het
Wnt3a A T 11: 59,290,583 I22N probably benign Het
Other mutations in Tmem30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tmem30c APN 16 57270074 missense probably damaging 1.00
IGL01115:Tmem30c APN 16 57276117 splice site probably benign
IGL01574:Tmem30c APN 16 57276742 missense possibly damaging 0.60
IGL02060:Tmem30c APN 16 57290898 missense probably benign
IGL03243:Tmem30c APN 16 57276150 missense probably benign 0.00
R0689:Tmem30c UTSW 16 57270173 missense probably damaging 1.00
R0699:Tmem30c UTSW 16 57276789 missense possibly damaging 0.69
R0763:Tmem30c UTSW 16 57270176 missense possibly damaging 0.90
R1353:Tmem30c UTSW 16 57277665 missense probably damaging 1.00
R1518:Tmem30c UTSW 16 57266492 missense probably damaging 0.99
R1707:Tmem30c UTSW 16 57266480 missense possibly damaging 0.79
R1843:Tmem30c UTSW 16 57276780 missense probably benign 0.02
R1865:Tmem30c UTSW 16 57269989 splice site probably benign
R2021:Tmem30c UTSW 16 57281362 missense probably damaging 1.00
R3419:Tmem30c UTSW 16 57277668 missense probably benign 0.25
R5007:Tmem30c UTSW 16 57266505 missense probably benign 0.00
R5204:Tmem30c UTSW 16 57270022 missense possibly damaging 0.89
R5863:Tmem30c UTSW 16 57270055 missense probably benign 0.02
R5869:Tmem30c UTSW 16 57266562 missense probably damaging 0.99
R6133:Tmem30c UTSW 16 57277737 missense probably damaging 1.00
R6359:Tmem30c UTSW 16 57276150 missense probably benign 0.00
R6813:Tmem30c UTSW 16 57281259 critical splice donor site probably null
R7268:Tmem30c UTSW 16 57266414 missense probably damaging 0.98
R7387:Tmem30c UTSW 16 57270023 missense probably benign 0.05
R8236:Tmem30c UTSW 16 57276179 missense probably null 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-11-08