Incidental Mutation 'R5626:Ms4a14'
ID441858
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission 043165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5626 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11304055 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 380 (F380L)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181137
Predicted Effect probably benign
Transcript: ENSMUST00000187467
AA Change: F380L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: F380L

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,431,981 Y148H probably benign Het
Adh1 G C 3: 138,280,410 V53L probably benign Het
Arfgap2 C T 2: 91,275,392 Q514* probably null Het
Calhm2 A C 19: 47,133,119 C204G probably damaging Het
Carhsp1 T C 16: 8,661,033 N119D probably benign Het
Cfap57 A G 4: 118,614,783 L133P probably damaging Het
Clcn4 A T 7: 7,289,018 V598E probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Ddi1 T C 9: 6,266,003 H122R probably benign Het
Dync1h1 A G 12: 110,641,141 T2697A probably benign Het
Ednrb T A 14: 103,843,128 I117F probably damaging Het
Egflam A G 15: 7,251,207 S446P possibly damaging Het
F5 A G 1: 164,209,035 I1922V probably damaging Het
Gpc1 T A 1: 92,857,119 probably null Het
Gphn A C 12: 78,683,897 I769L probably benign Het
Grid2 T C 6: 64,076,945 probably null Het
Hira G T 16: 18,927,512 Q468H probably damaging Het
Hmcn1 C T 1: 150,656,567 G3154E probably damaging Het
Ighv16-1 G A 12: 114,068,852 T92M probably damaging Het
Lcmt2 T C 2: 121,139,462 E380G probably benign Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Ncbp1 G A 4: 46,161,290 S422N probably damaging Het
Pcolce T A 5: 137,610,399 T26S probably damaging Het
Pitpnm3 T C 11: 72,112,332 I51V probably benign Het
Plcb3 T C 19: 6,955,275 S1041G probably benign Het
Ppp5c T C 7: 17,027,704 D37G probably benign Het
Prkca T C 11: 108,057,815 D116G possibly damaging Het
Qrsl1 A T 10: 43,881,520 D367E probably benign Het
Rbm26 T C 14: 105,144,231 T493A probably benign Het
Saxo1 T C 4: 86,445,589 E219G probably damaging Het
Slc22a16 A T 10: 40,584,853 probably null Het
Tmem30c T C 16: 57,276,143 N205S possibly damaging Het
Trp53i11 A G 2: 93,199,378 N119S possibly damaging Het
Wnt3a A T 11: 59,290,583 I22N probably benign Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4455:Ms4a14 UTSW 19 11303626 missense possibly damaging 0.53
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R5919:Ms4a14 UTSW 19 11314297 missense possibly damaging 0.86
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6585:Ms4a14 UTSW 19 11303645 missense unknown
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
R7401:Ms4a14 UTSW 19 11302230 missense possibly damaging 0.72
R7445:Ms4a14 UTSW 19 11302972 missense probably benign 0.00
R7489:Ms4a14 UTSW 19 11302031 missense probably benign 0.07
R7524:Ms4a14 UTSW 19 11303836 missense unknown
R7532:Ms4a14 UTSW 19 11303959 missense possibly damaging 0.86
R7689:Ms4a14 UTSW 19 11302542 missense probably benign 0.33
R7732:Ms4a14 UTSW 19 11301683 missense probably benign
R7737:Ms4a14 UTSW 19 11302786 nonsense probably null
R7860:Ms4a14 UTSW 19 11302944 missense probably benign
R8098:Ms4a14 UTSW 19 11304615 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGTACATCTTGGTTTGGAGACTC -3'
(R):5'- ATCACCTGAATGATGCGGAC -3'

Sequencing Primer
(F):5'- GGAGACTCTTGGGATTGAATCTC -3'
(R):5'- CTGAATGATGCGGACCTATCATC -3'
Posted On2016-11-08