Incidental Mutation 'R5627:Ano3'
ID 441869
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 043166-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5627 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110756953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 425 (N425S)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623] [ENSMUST00000140777]
AlphaFold A2AHL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: N425S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: N425S

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140777
AA Change: N81S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968
AA Change: N81S

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abl1 T C 2: 31,800,583 W705R probably benign Het
Alpk1 A T 3: 127,680,647 V569D probably damaging Het
Atad2b A G 12: 4,917,911 D68G probably benign Het
Cacna1e A G 1: 154,635,858 I173T probably damaging Het
Cenpe G T 3: 135,235,473 L716F possibly damaging Het
Cep85 A T 4: 134,134,097 L622Q probably damaging Het
Cep97 A G 16: 55,924,967 probably null Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chil5 A G 3: 106,019,635 L228P probably damaging Het
Col22a1 T C 15: 71,981,918 E265G probably damaging Het
Col3a1 T C 1: 45,331,560 probably benign Het
Cyp3a59 T A 5: 146,112,854 D497E probably benign Het
Egfem1 G T 3: 29,668,399 E175* probably null Het
Eif4g2 A G 7: 111,074,239 Y778H probably benign Het
Fam98b T C 2: 117,267,933 C295R probably damaging Het
Gm3149 A T 14: 4,324,703 I246L probably benign Het
Gm5134 A G 10: 75,986,108 T259A possibly damaging Het
Gm5150 A G 3: 15,963,400 Y236H probably damaging Het
Golga2 C A 2: 32,306,047 Y864* probably null Het
Inpp4a A G 1: 37,367,773 D199G probably damaging Het
Inpp4b T C 8: 81,743,816 probably benign Het
Kremen1 T C 11: 5,199,709 T321A probably benign Het
Map3k3 A G 11: 106,148,602 S250G probably benign Het
Mtmr10 A T 7: 64,336,752 K526M probably damaging Het
Nbea C T 3: 55,992,345 C1461Y probably damaging Het
Nckap5l A T 15: 99,427,706 N305K possibly damaging Het
Nup210l A T 3: 90,144,250 Y567F probably damaging Het
Olfr1002 T A 2: 85,647,647 I225F probably damaging Het
Olfr1242 A T 2: 89,494,044 N89K probably benign Het
Olfr1446 T A 19: 12,890,299 I93F probably damaging Het
Olfr292 G T 7: 86,695,139 V228F possibly damaging Het
Olfr661 G A 7: 104,688,170 V52M probably benign Het
Olfr742 A G 14: 50,515,800 M199V probably benign Het
Rcc1 T C 4: 132,338,143 R57G probably damaging Het
Rfx7 C T 9: 72,532,784 probably benign Het
Saraf T A 8: 34,154,645 M1K probably null Het
Serpinb9d C T 13: 33,202,693 T248I probably damaging Het
Slc38a6 A G 12: 73,343,683 I254M possibly damaging Het
Slc6a5 A G 7: 49,911,774 D18G possibly damaging Het
Supt20 A G 3: 54,713,190 D389G possibly damaging Het
Tecpr2 T A 12: 110,941,482 I1001K probably damaging Het
Vcan CAAAA CAA 13: 89,691,135 probably null Het
Wdr36 T A 18: 32,861,638 D717E possibly damaging Het
Zfp318 T C 17: 46,413,136 S2022P probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense possibly damaging 0.91
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGTGATAAGACCTCTTGGAAC -3'
(R):5'- AGATTTCCTCTGAAACCCTCGC -3'

Sequencing Primer
(F):5'- GTGATAAGACCTCTTGGAACATATC -3'
(R):5'- TCTGAAACCCTCGCCGCTG -3'
Posted On 2016-11-08