Incidental Mutation 'R5627:Cenpe'
ID 441878
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 043166-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5627 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 135212537-135273611 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 135235473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 716 (L716F)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062893
AA Change: L716F

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: L716F

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abl1 T C 2: 31,800,583 W705R probably benign Het
Alpk1 A T 3: 127,680,647 V569D probably damaging Het
Ano3 T C 2: 110,756,953 N425S possibly damaging Het
Atad2b A G 12: 4,917,911 D68G probably benign Het
Cacna1e A G 1: 154,635,858 I173T probably damaging Het
Cep85 A T 4: 134,134,097 L622Q probably damaging Het
Cep97 A G 16: 55,924,967 probably null Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chil5 A G 3: 106,019,635 L228P probably damaging Het
Col22a1 T C 15: 71,981,918 E265G probably damaging Het
Col3a1 T C 1: 45,331,560 probably benign Het
Cyp3a59 T A 5: 146,112,854 D497E probably benign Het
Egfem1 G T 3: 29,668,399 E175* probably null Het
Eif4g2 A G 7: 111,074,239 Y778H probably benign Het
Fam98b T C 2: 117,267,933 C295R probably damaging Het
Gm3149 A T 14: 4,324,703 I246L probably benign Het
Gm5134 A G 10: 75,986,108 T259A possibly damaging Het
Gm5150 A G 3: 15,963,400 Y236H probably damaging Het
Golga2 C A 2: 32,306,047 Y864* probably null Het
Inpp4a A G 1: 37,367,773 D199G probably damaging Het
Inpp4b T C 8: 81,743,816 probably benign Het
Kremen1 T C 11: 5,199,709 T321A probably benign Het
Map3k3 A G 11: 106,148,602 S250G probably benign Het
Mtmr10 A T 7: 64,336,752 K526M probably damaging Het
Nbea C T 3: 55,992,345 C1461Y probably damaging Het
Nckap5l A T 15: 99,427,706 N305K possibly damaging Het
Nup210l A T 3: 90,144,250 Y567F probably damaging Het
Olfr1002 T A 2: 85,647,647 I225F probably damaging Het
Olfr1242 A T 2: 89,494,044 N89K probably benign Het
Olfr1446 T A 19: 12,890,299 I93F probably damaging Het
Olfr292 G T 7: 86,695,139 V228F possibly damaging Het
Olfr661 G A 7: 104,688,170 V52M probably benign Het
Olfr742 A G 14: 50,515,800 M199V probably benign Het
Rcc1 T C 4: 132,338,143 R57G probably damaging Het
Rfx7 C T 9: 72,532,784 probably benign Het
Saraf T A 8: 34,154,645 M1K probably null Het
Serpinb9d C T 13: 33,202,693 T248I probably damaging Het
Slc38a6 A G 12: 73,343,683 I254M possibly damaging Het
Slc6a5 A G 7: 49,911,774 D18G possibly damaging Het
Supt20 A G 3: 54,713,190 D389G possibly damaging Het
Tecpr2 T A 12: 110,941,482 I1001K probably damaging Het
Vcan CAAAA CAA 13: 89,691,135 probably null Het
Wdr36 T A 18: 32,861,638 D717E possibly damaging Het
Zfp318 T C 17: 46,413,136 S2022P probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7973:Cenpe UTSW 3 135223250 missense probably damaging 1.00
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
R8425:Cenpe UTSW 3 135242627 nonsense probably null
R8488:Cenpe UTSW 3 135259241 missense probably damaging 1.00
R8811:Cenpe UTSW 3 135223240 missense probably damaging 1.00
R8850:Cenpe UTSW 3 135225016 missense probably damaging 1.00
R8879:Cenpe UTSW 3 135260101 missense probably damaging 0.99
R8899:Cenpe UTSW 3 135239883 missense probably benign 0.18
R9035:Cenpe UTSW 3 135270811 missense probably benign 0.01
R9038:Cenpe UTSW 3 135218036 missense probably benign 0.00
R9093:Cenpe UTSW 3 135239880 nonsense probably null
R9221:Cenpe UTSW 3 135230078 missense possibly damaging 0.90
R9365:Cenpe UTSW 3 135248446 missense possibly damaging 0.56
R9443:Cenpe UTSW 3 135270848 missense probably damaging 0.99
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCAAAGGAATTGAGAATGTTCCC -3'
(R):5'- GAGAGCACGAATTCCATTCCTTC -3'

Sequencing Primer
(F):5'- TGTTCCCAAAATTAAGTGGATGC -3'
(R):5'- GAATTCCATTCCTTCCCATCACACAC -3'
Posted On 2016-11-08