Mutagenetix > Incidental Mutation

Incidental Mutation 'R5627:Cep85'

441880

Institutional Source

Beutler Lab

Gene Symbol

Cep85

Ensembl Gene

ENSMUSG00000037443

Gene Name

centrosomal protein 85

Synonyms

2410030J07Rik, Ccdc21

MMRRC Submission

043166-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R5627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134129858-134187112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 134134097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 622 (L622Q)

Ref Sequence

ENSEMBL: ENSMUSP00000113351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040271] [ENSMUST00000121566]

AlphaFold

Q8BMK0

Predicted Effect

probably damaging
Transcript: ENSMUST00000040271
AA Change: L624Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: L624Q

Domain	Start	End	E-Value	Type
coiled coil region	333	656	N/A	INTRINSIC
coiled coil region	725	749	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121566
AA Change: L622Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: L622Q

Domain	Start	End	E-Value	Type
coiled coil region	331	654	N/A	INTRINSIC
coiled coil region	723	747	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138144

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Abl1	T	C	2: 31,800,583	W705R	probably benign	Het
Alpk1	A	T	3: 127,680,647	V569D	probably damaging	Het
Ano3	T	C	2: 110,756,953	N425S	possibly damaging	Het
Atad2b	A	G	12: 4,917,911	D68G	probably benign	Het
Cacna1e	A	G	1: 154,635,858	I173T	probably damaging	Het
Cenpe	G	T	3: 135,235,473	L716F	possibly damaging	Het
Cep97	A	G	16: 55,924,967		probably null	Het
Ces1f	A	T	8: 93,279,699	M1K	probably null	Het
Chil5	A	G	3: 106,019,635	L228P	probably damaging	Het
Col22a1	T	C	15: 71,981,918	E265G	probably damaging	Het
Col3a1	T	C	1: 45,331,560		probably benign	Het
Cyp3a59	T	A	5: 146,112,854	D497E	probably benign	Het
Egfem1	G	T	3: 29,668,399	E175*	probably null	Het
Eif4g2	A	G	7: 111,074,239	Y778H	probably benign	Het
Fam98b	T	C	2: 117,267,933	C295R	probably damaging	Het
Gm3149	A	T	14: 4,324,703	I246L	probably benign	Het
Gm5134	A	G	10: 75,986,108	T259A	possibly damaging	Het
Gm5150	A	G	3: 15,963,400	Y236H	probably damaging	Het
Golga2	C	A	2: 32,306,047	Y864*	probably null	Het
Inpp4a	A	G	1: 37,367,773	D199G	probably damaging	Het
Inpp4b	T	C	8: 81,743,816		probably benign	Het
Kremen1	T	C	11: 5,199,709	T321A	probably benign	Het
Map3k3	A	G	11: 106,148,602	S250G	probably benign	Het
Mtmr10	A	T	7: 64,336,752	K526M	probably damaging	Het
Nbea	C	T	3: 55,992,345	C1461Y	probably damaging	Het
Nckap5l	A	T	15: 99,427,706	N305K	possibly damaging	Het
Nup210l	A	T	3: 90,144,250	Y567F	probably damaging	Het
Olfr1002	T	A	2: 85,647,647	I225F	probably damaging	Het
Olfr1242	A	T	2: 89,494,044	N89K	probably benign	Het
Olfr1446	T	A	19: 12,890,299	I93F	probably damaging	Het
Olfr292	G	T	7: 86,695,139	V228F	possibly damaging	Het
Olfr661	G	A	7: 104,688,170	V52M	probably benign	Het
Olfr742	A	G	14: 50,515,800	M199V	probably benign	Het
Rcc1	T	C	4: 132,338,143	R57G	probably damaging	Het
Rfx7	C	T	9: 72,532,784		probably benign	Het
Saraf	T	A	8: 34,154,645	M1K	probably null	Het
Serpinb9d	C	T	13: 33,202,693	T248I	probably damaging	Het
Slc38a6	A	G	12: 73,343,683	I254M	possibly damaging	Het
Slc6a5	A	G	7: 49,911,774	D18G	possibly damaging	Het
Supt20	A	G	3: 54,713,190	D389G	possibly damaging	Het
Tecpr2	T	A	12: 110,941,482	I1001K	probably damaging	Het
Vcan	CAAAA	CAA	13: 89,691,135		probably null	Het
Wdr36	T	A	18: 32,861,638	D717E	possibly damaging	Het
Zfp318	T	C	17: 46,413,136	S2022P	probably damaging	Het

Other mutations in Cep85

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Cep85	APN	4	134148761	missense	possibly damaging	0.63
IGL01397:Cep85	APN	4	134156206	missense	probably damaging	1.00
IGL01472:Cep85	APN	4	134134166	missense	possibly damaging	0.55
IGL01522:Cep85	APN	4	134152255	missense	probably damaging	1.00
IGL01522:Cep85	APN	4	134152256	missense	probably damaging	1.00
IGL02004:Cep85	APN	4	134167387	missense	probably damaging	1.00
IGL02043:Cep85	APN	4	134155727	missense	probably benign	0.02
IGL02187:Cep85	APN	4	134131305	missense	possibly damaging	0.86
IGL02317:Cep85	APN	4	134155811	missense	probably damaging	1.00
IGL02543:Cep85	APN	4	134156323	missense	possibly damaging	0.52
1mM(1):Cep85	UTSW	4	134156264	missense	possibly damaging	0.88
PIT4468001:Cep85	UTSW	4	134148697	missense	probably damaging	1.00
R0060:Cep85	UTSW	4	134167300	missense	probably damaging	1.00
R0068:Cep85	UTSW	4	134154295	missense	probably benign	0.00
R0346:Cep85	UTSW	4	134132422	missense	probably damaging	1.00
R0462:Cep85	UTSW	4	134131421	missense	possibly damaging	0.88
R1295:Cep85	UTSW	4	134167400	missense	probably damaging	1.00
R1296:Cep85	UTSW	4	134167400	missense	probably damaging	1.00
R1472:Cep85	UTSW	4	134167400	missense	probably damaging	1.00
R1577:Cep85	UTSW	4	134152288	missense	probably damaging	1.00
R1681:Cep85	UTSW	4	134148728	nonsense	probably null
R1687:Cep85	UTSW	4	134148013	missense	probably benign	0.00
R2031:Cep85	UTSW	4	134132450	missense	probably benign	0.00
R2216:Cep85	UTSW	4	134131430	missense	possibly damaging	0.62
R2220:Cep85	UTSW	4	134153867	missense	probably damaging	1.00
R4321:Cep85	UTSW	4	134132285	missense	probably damaging	1.00
R4888:Cep85	UTSW	4	134164751	intron	probably benign
R5044:Cep85	UTSW	4	134156179	missense	probably damaging	0.97
R5075:Cep85	UTSW	4	134132367	missense	probably damaging	1.00
R6841:Cep85	UTSW	4	134155856	missense	probably benign
R6842:Cep85	UTSW	4	134155856	missense	probably benign
R6843:Cep85	UTSW	4	134155856	missense	probably benign
R6981:Cep85	UTSW	4	134152261	missense	probably damaging	1.00
R7252:Cep85	UTSW	4	134148031	missense	probably benign	0.12
R7869:Cep85	UTSW	4	134132298	missense	probably damaging	0.99
R8057:Cep85	UTSW	4	134153614	unclassified	probably benign
R8194:Cep85	UTSW	4	134134089	missense	probably null	0.00
R8733:Cep85	UTSW	4	134148161	missense	possibly damaging	0.87
R8928:Cep85	UTSW	4	134132404	missense	probably benign	0.00
R9430:Cep85	UTSW	4	134167354	missense	probably damaging	1.00
R9550:Cep85	UTSW	4	134131287	missense	probably damaging	1.00
V8831:Cep85	UTSW	4	134156069	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CACTCTCAGACAAGCCTAGG -3'
(R):5'- TGGAATGTAGCGGCTCTCAG -3'

Sequencing Primer
(F):5'- GCTAAAAGCTTACCTCCCC -3'
(R):5'- TCTCAGCCCTTAGAGCAGCTG -3'

Posted On

2016-11-08