Incidental Mutation 'R5627:Olfr1446'
ID441907
Institutional Source Beutler Lab
Gene Symbol Olfr1446
Ensembl Gene ENSMUSG00000057817
Gene Nameolfactory receptor 1446
SynonymsGA_x6K02T2RE5P-3220047-3219130, MOR202-2
MMRRC Submission 043166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5627 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12888266-12893524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12890299 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 93 (I93F)
Ref Sequence ENSEMBL: ENSMUSP00000149198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081236] [ENSMUST00000207741] [ENSMUST00000216805]
Predicted Effect probably damaging
Transcript: ENSMUST00000081236
AA Change: I93F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079994
Gene: ENSMUSG00000057817
AA Change: I93F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 5.1e-6 PFAM
Pfam:7tm_1 42 291 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207319
AA Change: I93F
Predicted Effect probably benign
Transcript: ENSMUST00000207741
Predicted Effect probably damaging
Transcript: ENSMUST00000216805
AA Change: I93F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abl1 T C 2: 31,800,583 W705R probably benign Het
Alpk1 A T 3: 127,680,647 V569D probably damaging Het
Ano3 T C 2: 110,756,953 N425S possibly damaging Het
Atad2b A G 12: 4,917,911 D68G probably benign Het
Cacna1e A G 1: 154,635,858 I173T probably damaging Het
Cenpe G T 3: 135,235,473 L716F possibly damaging Het
Cep85 A T 4: 134,134,097 L622Q probably damaging Het
Cep97 A G 16: 55,924,967 probably null Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chil5 A G 3: 106,019,635 L228P probably damaging Het
Col22a1 T C 15: 71,981,918 E265G probably damaging Het
Col3a1 T C 1: 45,331,560 probably benign Het
Cyp3a59 T A 5: 146,112,854 D497E probably benign Het
Egfem1 G T 3: 29,668,399 E175* probably null Het
Eif4g2 A G 7: 111,074,239 Y778H probably benign Het
Fam98b T C 2: 117,267,933 C295R probably damaging Het
Gm3149 A T 14: 4,324,703 I246L probably benign Het
Gm5134 A G 10: 75,986,108 T259A possibly damaging Het
Gm5150 A G 3: 15,963,400 Y236H probably damaging Het
Golga2 C A 2: 32,306,047 Y864* probably null Het
Inpp4a A G 1: 37,367,773 D199G probably damaging Het
Inpp4b T C 8: 81,743,816 probably benign Het
Kremen1 T C 11: 5,199,709 T321A probably benign Het
Map3k3 A G 11: 106,148,602 S250G probably benign Het
Mtmr10 A T 7: 64,336,752 K526M probably damaging Het
Nbea C T 3: 55,992,345 C1461Y probably damaging Het
Nckap5l A T 15: 99,427,706 N305K possibly damaging Het
Nup210l A T 3: 90,144,250 Y567F probably damaging Het
Olfr1002 T A 2: 85,647,647 I225F probably damaging Het
Olfr1242 A T 2: 89,494,044 N89K probably benign Het
Olfr292 G T 7: 86,695,139 V228F possibly damaging Het
Olfr661 G A 7: 104,688,170 V52M probably benign Het
Olfr742 A G 14: 50,515,800 M199V probably benign Het
Rcc1 T C 4: 132,338,143 R57G probably damaging Het
Rfx7 C T 9: 72,532,784 probably benign Het
Saraf T A 8: 34,154,645 M1K probably null Het
Serpinb9d C T 13: 33,202,693 T248I probably damaging Het
Slc38a6 A G 12: 73,343,683 I254M possibly damaging Het
Slc6a5 A G 7: 49,911,774 D18G possibly damaging Het
Supt20 A G 3: 54,713,190 D389G possibly damaging Het
Tecpr2 T A 12: 110,941,482 I1001K probably damaging Het
Vcan CAAAA CAA 13: 89,691,135 probably null Het
Wdr36 T A 18: 32,861,638 D717E possibly damaging Het
Zfp318 T C 17: 46,413,136 S2022P probably damaging Het
Other mutations in Olfr1446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Olfr1446 APN 19 12889918 missense probably benign 0.00
IGL01399:Olfr1446 APN 19 12890439 missense probably benign 0.28
IGL01697:Olfr1446 APN 19 12890467 missense probably benign 0.24
IGL01739:Olfr1446 APN 19 12890149 missense probably benign 0.02
IGL01894:Olfr1446 APN 19 12889643 utr 3 prime probably benign
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R1163:Olfr1446 UTSW 19 12890149 missense probably benign 0.02
R1769:Olfr1446 UTSW 19 12889683 missense probably damaging 1.00
R4406:Olfr1446 UTSW 19 12890234 nonsense probably null
R5038:Olfr1446 UTSW 19 12890406 missense probably damaging 1.00
R5207:Olfr1446 UTSW 19 12890437 missense probably benign 0.28
R5995:Olfr1446 UTSW 19 12890597 splice site probably null
R8043:Olfr1446 UTSW 19 12889731 missense probably damaging 1.00
R8254:Olfr1446 UTSW 19 12890485 missense probably benign 0.00
X0062:Olfr1446 UTSW 19 12890563 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ATCCCATAAGAGGCAGTGATAATC -3'
(R):5'- TCACCAATGACCCAGGCATG -3'

Sequencing Primer
(F):5'- GGCAGTGATAATCCTTGTATACACAC -3'
(R):5'- ACCCAGGCATGCAGCTTC -3'
Posted On2016-11-08