Incidental Mutation 'R5628:Mindy4'
ID441921
Institutional Source Beutler Lab
Gene Symbol Mindy4
Ensembl Gene ENSMUSG00000038022
Gene NameMINDY lysine 48 deubiquitinase 4
SynonymsC330043M08Rik, LOC384387, Fam188b
MMRRC Submission 043167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5628 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55203383-55320222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55260594 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 385 (L385F)
Ref Sequence ENSEMBL: ENSMUSP00000145151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053094] [ENSMUST00000204842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053094
AA Change: L385F

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061221
Gene: ENSMUSG00000038022
AA Change: L385F

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
low complexity region 265 277 N/A INTRINSIC
DUF4205 403 739 1.47e-187 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204842
AA Change: L385F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145151
Gene: ENSMUSG00000038022
AA Change: L385F

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
low complexity region 265 277 N/A INTRINSIC
DUF4205 403 591 6.19e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,710 D671G probably benign Het
Ap3b1 A G 13: 94,477,048 D685G unknown Het
Atp6v1h G A 1: 5,135,889 W358* probably null Het
Atr T A 9: 95,874,226 Y830* probably null Het
B3galnt2 A T 13: 13,995,152 probably null Het
Casz1 T C 4: 148,946,096 Y1191H probably damaging Het
Cdc40 T G 10: 40,851,053 E169D probably benign Het
Cep55 C T 19: 38,069,948 Q330* probably null Het
Clcn1 T C 6: 42,298,889 V315A probably damaging Het
Cmya5 A G 13: 93,089,710 F2957L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dync1li2 T C 8: 104,420,592 N490S possibly damaging Het
Ephb3 T C 16: 21,218,119 Y111H probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fat3 T C 9: 15,966,096 Y3407C probably damaging Het
Fbxw8 A G 5: 118,092,557 V393A probably damaging Het
Fnip1 A T 11: 54,503,633 D965V probably benign Het
Gramd2 T C 9: 59,707,723 M3T probably benign Het
Kctd15 T C 7: 34,640,295 D283G probably damaging Het
Kif9 C T 9: 110,514,553 R547* probably null Het
Map4 A G 9: 110,081,847 T245A probably benign Het
Myo7b A G 18: 31,974,187 C1252R probably benign Het
Myt1l T A 12: 29,811,621 I134N unknown Het
Olfr1022 T A 2: 85,868,805 I71N probably damaging Het
Osgin2 T A 4: 15,998,998 N208I probably benign Het
Polr2b G A 5: 77,313,216 V29M probably damaging Het
Prdm15 T A 16: 97,799,623 M812L probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rev3l T A 10: 39,822,967 N1153K probably damaging Het
Rnf17 A G 14: 56,486,952 probably null Het
Rusc2 C T 4: 43,425,348 T1151M probably damaging Het
Scrib T C 15: 76,049,540 T30A possibly damaging Het
Sephs1 T C 2: 4,889,207 I73T probably benign Het
Sf3b1 C T 1: 54,998,175 A861T probably benign Het
Shq1 A G 6: 100,631,003 W316R probably damaging Het
Slc26a5 T A 5: 21,816,976 D484V probably benign Het
Smg1 C T 7: 118,154,701 probably benign Het
Stard5 T C 7: 83,633,147 I56T probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tmem217 A T 17: 29,526,456 I100N probably damaging Het
Trpm2 C T 10: 77,912,636 R1400Q probably benign Het
Vmn1r82 T G 7: 12,305,278 N41K probably damaging Het
Zfp236 T C 18: 82,657,122 D367G probably damaging Het
Zfyve1 A T 12: 83,574,889 V244E probably benign Het
Other mutations in Mindy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Mindy4 APN 6 55284742 splice site probably benign
IGL01483:Mindy4 APN 6 55216685 missense probably damaging 1.00
IGL01721:Mindy4 APN 6 55223999 missense probably damaging 1.00
IGL01965:Mindy4 APN 6 55260532 splice site probably benign
IGL02214:Mindy4 APN 6 55216651 missense possibly damaging 0.88
IGL03058:Mindy4 APN 6 55308198 missense probably damaging 1.00
IGL03077:Mindy4 APN 6 55309330 missense probably damaging 1.00
IGL03296:Mindy4 APN 6 55297753 critical splice donor site probably null
R0383:Mindy4 UTSW 6 55276634 missense probably benign 0.00
R0384:Mindy4 UTSW 6 55216684 missense probably damaging 1.00
R0636:Mindy4 UTSW 6 55276585 missense possibly damaging 0.73
R0848:Mindy4 UTSW 6 55318286 nonsense probably null
R1171:Mindy4 UTSW 6 55255616 missense possibly damaging 0.75
R1210:Mindy4 UTSW 6 55284813 missense possibly damaging 0.92
R1341:Mindy4 UTSW 6 55255616 missense probably benign 0.00
R2030:Mindy4 UTSW 6 55211262 missense probably damaging 1.00
R2127:Mindy4 UTSW 6 55218265 missense probably benign 0.05
R2237:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2238:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2250:Mindy4 UTSW 6 55300949 missense probably damaging 0.99
R2571:Mindy4 UTSW 6 55284785 missense probably damaging 1.00
R2846:Mindy4 UTSW 6 55278100 missense probably damaging 1.00
R3001:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3002:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3498:Mindy4 UTSW 6 55216525 missense probably benign 0.01
R4167:Mindy4 UTSW 6 55224346 missense possibly damaging 0.93
R4767:Mindy4 UTSW 6 55260565 missense probably damaging 0.98
R4812:Mindy4 UTSW 6 55279103 missense possibly damaging 0.64
R5109:Mindy4 UTSW 6 55216745 splice site probably null
R5203:Mindy4 UTSW 6 55255661 missense probably benign 0.00
R5221:Mindy4 UTSW 6 55224107 missense probably benign
R6265:Mindy4 UTSW 6 55301064 missense probably damaging 0.99
R6596:Mindy4 UTSW 6 55224016 missense probably damaging 0.99
R7084:Mindy4 UTSW 6 55278235 missense probably benign
R7350:Mindy4 UTSW 6 55301025 missense probably damaging 0.97
R7535:Mindy4 UTSW 6 55297753 critical splice donor site probably null
R7625:Mindy4 UTSW 6 55276613 missense possibly damaging 0.95
R8052:Mindy4 UTSW 6 55300992 missense probably damaging 0.99
R8727:Mindy4 UTSW 6 55279070 unclassified probably benign
R8884:Mindy4 UTSW 6 55278238 missense probably benign 0.00
R8886:Mindy4 UTSW 6 55278238 missense probably benign 0.00
R8890:Mindy4 UTSW 6 55278238 missense probably benign 0.00
R8892:Mindy4 UTSW 6 55278238 missense probably benign 0.00
R8893:Mindy4 UTSW 6 55278238 missense probably benign 0.00
R8894:Mindy4 UTSW 6 55278238 missense probably benign 0.00
R8896:Mindy4 UTSW 6 55278238 missense probably benign 0.00
X0065:Mindy4 UTSW 6 55262816 missense probably damaging 0.99
Z1177:Mindy4 UTSW 6 55224341 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGGTTGATGTCCAGGCTGAG -3'
(R):5'- AGCAGGGTCCTACAGCATCTAG -3'

Sequencing Primer
(F):5'- GGCTGAGGCAAGTTTCTCCAAAC -3'
(R):5'- AGGGTCAGGTTCCTTATACATCAC -3'
Posted On2016-11-08