Incidental Mutation 'R5628:Dync1li2'
ID441933
Institutional Source Beutler Lab
Gene Symbol Dync1li2
Ensembl Gene ENSMUSG00000035770
Gene Namedynein, cytoplasmic 1 light intermediate chain 2
SynonymsLIC2, Dnclic2, Dncli2
MMRRC Submission 043167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5628 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104417680-104443047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104420592 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 490 (N490S)
Ref Sequence ENSEMBL: ENSMUSP00000045480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041769] [ENSMUST00000212654]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041769
AA Change: N490S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045480
Gene: ENSMUSG00000035770
AA Change: N490S

DomainStartEndE-ValueType
Pfam:DLIC 30 491 5.8e-264 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000212230
AA Change: N403S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212343
Predicted Effect probably benign
Transcript: ENSMUST00000212654
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic dynein is a microtubule-associated motor protein (Hughes et al., 1995 [PubMed 7738094]). See DYNC1H1 (MIM 600112) for general information about dyneins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,710 D671G probably benign Het
Ap3b1 A G 13: 94,477,048 D685G unknown Het
Atp6v1h G A 1: 5,135,889 W358* probably null Het
Atr T A 9: 95,874,226 Y830* probably null Het
B3galnt2 A T 13: 13,995,152 probably null Het
Casz1 T C 4: 148,946,096 Y1191H probably damaging Het
Cdc40 T G 10: 40,851,053 E169D probably benign Het
Cep55 C T 19: 38,069,948 Q330* probably null Het
Clcn1 T C 6: 42,298,889 V315A probably damaging Het
Cmya5 A G 13: 93,089,710 F2957L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ephb3 T C 16: 21,218,119 Y111H probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fat3 T C 9: 15,966,096 Y3407C probably damaging Het
Fbxw8 A G 5: 118,092,557 V393A probably damaging Het
Fnip1 A T 11: 54,503,633 D965V probably benign Het
Gramd2 T C 9: 59,707,723 M3T probably benign Het
Kctd15 T C 7: 34,640,295 D283G probably damaging Het
Kif9 C T 9: 110,514,553 R547* probably null Het
Map4 A G 9: 110,081,847 T245A probably benign Het
Mindy4 C T 6: 55,260,594 L385F probably damaging Het
Myo7b A G 18: 31,974,187 C1252R probably benign Het
Myt1l T A 12: 29,811,621 I134N unknown Het
Olfr1022 T A 2: 85,868,805 I71N probably damaging Het
Osgin2 T A 4: 15,998,998 N208I probably benign Het
Polr2b G A 5: 77,313,216 V29M probably damaging Het
Prdm15 T A 16: 97,799,623 M812L probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rev3l T A 10: 39,822,967 N1153K probably damaging Het
Rnf17 A G 14: 56,486,952 probably null Het
Rusc2 C T 4: 43,425,348 T1151M probably damaging Het
Scrib T C 15: 76,049,540 T30A possibly damaging Het
Sephs1 T C 2: 4,889,207 I73T probably benign Het
Sf3b1 C T 1: 54,998,175 A861T probably benign Het
Shq1 A G 6: 100,631,003 W316R probably damaging Het
Slc26a5 T A 5: 21,816,976 D484V probably benign Het
Smg1 C T 7: 118,154,701 probably benign Het
Stard5 T C 7: 83,633,147 I56T probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tmem217 A T 17: 29,526,456 I100N probably damaging Het
Trpm2 C T 10: 77,912,636 R1400Q probably benign Het
Vmn1r82 T G 7: 12,305,278 N41K probably damaging Het
Zfp236 T C 18: 82,657,122 D367G probably damaging Het
Zfyve1 A T 12: 83,574,889 V244E probably benign Het
Other mutations in Dync1li2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Dync1li2 APN 8 104442498 missense possibly damaging 0.95
IGL01143:Dync1li2 APN 8 104429453 missense probably damaging 0.96
E0354:Dync1li2 UTSW 8 104425467 missense probably damaging 0.99
R0102:Dync1li2 UTSW 8 104428125 missense probably benign 0.00
R0102:Dync1li2 UTSW 8 104428125 missense probably benign 0.00
R0555:Dync1li2 UTSW 8 104420665 missense probably benign
R0784:Dync1li2 UTSW 8 104442498 missense probably damaging 0.99
R1532:Dync1li2 UTSW 8 104426035 missense probably damaging 1.00
R1632:Dync1li2 UTSW 8 104437491 missense probably damaging 0.99
R2877:Dync1li2 UTSW 8 104429415 missense probably damaging 1.00
R2878:Dync1li2 UTSW 8 104429415 missense probably damaging 1.00
R4272:Dync1li2 UTSW 8 104423143 missense probably damaging 0.96
R4380:Dync1li2 UTSW 8 104428166 missense probably damaging 1.00
R5050:Dync1li2 UTSW 8 104437441 missense probably damaging 1.00
R5218:Dync1li2 UTSW 8 104442547 nonsense probably null
R5501:Dync1li2 UTSW 8 104440472 critical splice donor site probably null
R6542:Dync1li2 UTSW 8 104442764 missense probably benign 0.09
R6727:Dync1li2 UTSW 8 104440535 missense probably damaging 0.98
R7384:Dync1li2 UTSW 8 104442543 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCATCTCACACTCGGACAAG -3'
(R):5'- TGCTGTCACTAGGAAAGATGGG -3'

Sequencing Primer
(F):5'- CTCGGACAAGCCAAAGAAGTATATG -3'
(R):5'- TCTACAGAGTAAGTTCCTGGACAGC -3'
Posted On2016-11-08