Incidental Mutation 'R5628:Rev3l'
ID441938
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene NameREV3 like, DNA directed polymerase zeta catalytic subunit
SynonymsSez4, Rev
MMRRC Submission 043167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5628 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39732118-39875211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39822967 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1153 (N1153K)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
Predicted Effect probably damaging
Transcript: ENSMUST00000019986
AA Change: N1153K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: N1153K

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164763
AA Change: N1153K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: N1153K

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,710 D671G probably benign Het
Ap3b1 A G 13: 94,477,048 D685G unknown Het
Atp6v1h G A 1: 5,135,889 W358* probably null Het
Atr T A 9: 95,874,226 Y830* probably null Het
B3galnt2 A T 13: 13,995,152 probably null Het
Casz1 T C 4: 148,946,096 Y1191H probably damaging Het
Cdc40 T G 10: 40,851,053 E169D probably benign Het
Cep55 C T 19: 38,069,948 Q330* probably null Het
Clcn1 T C 6: 42,298,889 V315A probably damaging Het
Cmya5 A G 13: 93,089,710 F2957L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dync1li2 T C 8: 104,420,592 N490S possibly damaging Het
Ephb3 T C 16: 21,218,119 Y111H probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fat3 T C 9: 15,966,096 Y3407C probably damaging Het
Fbxw8 A G 5: 118,092,557 V393A probably damaging Het
Fnip1 A T 11: 54,503,633 D965V probably benign Het
Gramd2 T C 9: 59,707,723 M3T probably benign Het
Kctd15 T C 7: 34,640,295 D283G probably damaging Het
Kif9 C T 9: 110,514,553 R547* probably null Het
Map4 A G 9: 110,081,847 T245A probably benign Het
Mindy4 C T 6: 55,260,594 L385F probably damaging Het
Myo7b A G 18: 31,974,187 C1252R probably benign Het
Myt1l T A 12: 29,811,621 I134N unknown Het
Olfr1022 T A 2: 85,868,805 I71N probably damaging Het
Osgin2 T A 4: 15,998,998 N208I probably benign Het
Polr2b G A 5: 77,313,216 V29M probably damaging Het
Prdm15 T A 16: 97,799,623 M812L probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rnf17 A G 14: 56,486,952 probably null Het
Rusc2 C T 4: 43,425,348 T1151M probably damaging Het
Scrib T C 15: 76,049,540 T30A possibly damaging Het
Sephs1 T C 2: 4,889,207 I73T probably benign Het
Sf3b1 C T 1: 54,998,175 A861T probably benign Het
Shq1 A G 6: 100,631,003 W316R probably damaging Het
Slc26a5 T A 5: 21,816,976 D484V probably benign Het
Smg1 C T 7: 118,154,701 probably benign Het
Stard5 T C 7: 83,633,147 I56T probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tmem217 A T 17: 29,526,456 I100N probably damaging Het
Trpm2 C T 10: 77,912,636 R1400Q probably benign Het
Vmn1r82 T G 7: 12,305,278 N41K probably damaging Het
Zfp236 T C 18: 82,657,122 D367G probably damaging Het
Zfyve1 A T 12: 83,574,889 V244E probably benign Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
R7575:Rev3l UTSW 10 39821445 missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R7597:Rev3l UTSW 10 39822884 missense probably damaging 1.00
R7670:Rev3l UTSW 10 39836722 missense probably benign 0.01
R7804:Rev3l UTSW 10 39823485 missense probably benign 0.34
R7818:Rev3l UTSW 10 39823902 missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R7957:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R8059:Rev3l UTSW 10 39843495 missense probably damaging 1.00
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGCTGAAACCGAAGACTGTG -3'
(R):5'- ATTGCATGTTTCCTTGACAGAC -3'

Sequencing Primer
(F):5'- CCGAAGACTGTGACTTGAGTTATAG -3'
(R):5'- GACAGACTTTTCTCATTGGCTC -3'
Posted On2016-11-08