Incidental Mutation 'R5628:Myt1l'
ID441943
Institutional Source Beutler Lab
Gene Symbol Myt1l
Ensembl Gene ENSMUSG00000061911
Gene Namemyelin transcription factor 1-like
SynonymsC630034G21Rik, Nztf1, 2900046C06Rik, 2900093J19Rik, Png-1, Pmng1
MMRRC Submission 043167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5628 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location29528384-29923213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29811621 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 134 (I134N)
Ref Sequence ENSEMBL: ENSMUSP00000151588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021009] [ENSMUST00000049784] [ENSMUST00000218583]
Predicted Effect unknown
Transcript: ENSMUST00000021009
AA Change: I134N
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911
AA Change: I134N

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000049784
AA Change: I134N
SMART Domains Protein: ENSMUSP00000058264
Gene: ENSMUSG00000061911
AA Change: I134N

DomainStartEndE-ValueType
Pfam:zf-C2HC 30 58 5.1e-18 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 506 533 9.9e-15 PFAM
Pfam:zf-C2HC 550 578 2.4e-16 PFAM
Pfam:MYT1 622 873 2.7e-122 PFAM
Pfam:zf-C2HC 905 933 6.3e-19 PFAM
Pfam:zf-C2HC 954 982 1.6e-18 PFAM
Pfam:zf-C2HC 1007 1035 1.4e-16 PFAM
coiled coil region 1057 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218583
AA Change: I134N
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger superfamily of transcription factors. The encoded protein belongs to a novel class of cystein-cystein-histidine-cystein zinc finger proteins that function in the developing mammalian central nervous system. Forced expression of this gene in combination with the basic helix-loop-helix transcription factor NeuroD1 and the transcription factors POU class 3 homeobox 2 and achaete-scute family basic helix-loop-helix transcription factor 1 can convert fetal and postnatal human fibroblasts into induced neuronal cells, which are able to generate action potentials. Mutations in this gene have been associated with autosomal mental retardation-39 and autism spectrum disorder. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,710 D671G probably benign Het
Ap3b1 A G 13: 94,477,048 D685G unknown Het
Atp6v1h G A 1: 5,135,889 W358* probably null Het
Atr T A 9: 95,874,226 Y830* probably null Het
B3galnt2 A T 13: 13,995,152 probably null Het
Casz1 T C 4: 148,946,096 Y1191H probably damaging Het
Cdc40 T G 10: 40,851,053 E169D probably benign Het
Cep55 C T 19: 38,069,948 Q330* probably null Het
Clcn1 T C 6: 42,298,889 V315A probably damaging Het
Cmya5 A G 13: 93,089,710 F2957L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dync1li2 T C 8: 104,420,592 N490S possibly damaging Het
Ephb3 T C 16: 21,218,119 Y111H probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fat3 T C 9: 15,966,096 Y3407C probably damaging Het
Fbxw8 A G 5: 118,092,557 V393A probably damaging Het
Fnip1 A T 11: 54,503,633 D965V probably benign Het
Gramd2 T C 9: 59,707,723 M3T probably benign Het
Kctd15 T C 7: 34,640,295 D283G probably damaging Het
Kif9 C T 9: 110,514,553 R547* probably null Het
Map4 A G 9: 110,081,847 T245A probably benign Het
Mindy4 C T 6: 55,260,594 L385F probably damaging Het
Myo7b A G 18: 31,974,187 C1252R probably benign Het
Olfr1022 T A 2: 85,868,805 I71N probably damaging Het
Osgin2 T A 4: 15,998,998 N208I probably benign Het
Polr2b G A 5: 77,313,216 V29M probably damaging Het
Prdm15 T A 16: 97,799,623 M812L probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rev3l T A 10: 39,822,967 N1153K probably damaging Het
Rnf17 A G 14: 56,486,952 probably null Het
Rusc2 C T 4: 43,425,348 T1151M probably damaging Het
Scrib T C 15: 76,049,540 T30A possibly damaging Het
Sephs1 T C 2: 4,889,207 I73T probably benign Het
Sf3b1 C T 1: 54,998,175 A861T probably benign Het
Shq1 A G 6: 100,631,003 W316R probably damaging Het
Slc26a5 T A 5: 21,816,976 D484V probably benign Het
Smg1 C T 7: 118,154,701 probably benign Het
Stard5 T C 7: 83,633,147 I56T probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tmem217 A T 17: 29,526,456 I100N probably damaging Het
Trpm2 C T 10: 77,912,636 R1400Q probably benign Het
Vmn1r82 T G 7: 12,305,278 N41K probably damaging Het
Zfp236 T C 18: 82,657,122 D367G probably damaging Het
Zfyve1 A T 12: 83,574,889 V244E probably benign Het
Other mutations in Myt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Myt1l APN 12 29827424 missense unknown
IGL00896:Myt1l APN 12 29826886 missense unknown
IGL01653:Myt1l APN 12 29910771 missense unknown
IGL02632:Myt1l APN 12 29914293 missense unknown
IGL03088:Myt1l APN 12 29920477 missense probably benign 0.03
IGL03212:Myt1l APN 12 29827820 missense unknown
R0057:Myt1l UTSW 12 29842612 splice site probably null
R0126:Myt1l UTSW 12 29851720 missense possibly damaging 0.91
R0356:Myt1l UTSW 12 29811501 missense unknown
R0538:Myt1l UTSW 12 29842571 missense possibly damaging 0.47
R0587:Myt1l UTSW 12 29811635 missense unknown
R0629:Myt1l UTSW 12 29811485 missense unknown
R0709:Myt1l UTSW 12 29827733 missense unknown
R0736:Myt1l UTSW 12 29827814 missense unknown
R0920:Myt1l UTSW 12 29886139 missense unknown
R1618:Myt1l UTSW 12 29827397 missense unknown
R1660:Myt1l UTSW 12 29895273 missense unknown
R1716:Myt1l UTSW 12 29811538 missense unknown
R1758:Myt1l UTSW 12 29827242 missense unknown
R1852:Myt1l UTSW 12 29851661 missense probably benign 0.27
R1971:Myt1l UTSW 12 29827092 missense unknown
R2120:Myt1l UTSW 12 29783619 critical splice acceptor site probably null
R2227:Myt1l UTSW 12 29826970 missense unknown
R2865:Myt1l UTSW 12 29910789 missense probably benign 0.00
R4587:Myt1l UTSW 12 29910801 missense unknown
R4603:Myt1l UTSW 12 29842540 missense probably benign 0.01
R4659:Myt1l UTSW 12 29849457 missense probably damaging 0.98
R4734:Myt1l UTSW 12 29919926 missense possibly damaging 0.90
R4786:Myt1l UTSW 12 29811458 missense unknown
R4824:Myt1l UTSW 12 29849400 missense probably benign 0.02
R4835:Myt1l UTSW 12 29895305 missense unknown
R4888:Myt1l UTSW 12 29886139 missense unknown
R4976:Myt1l UTSW 12 29832303 missense unknown
R4980:Myt1l UTSW 12 29827039 missense unknown
R5119:Myt1l UTSW 12 29832303 missense unknown
R5194:Myt1l UTSW 12 29811648 missense unknown
R5247:Myt1l UTSW 12 29832332 missense unknown
R5249:Myt1l UTSW 12 29832332 missense unknown
R5427:Myt1l UTSW 12 29832332 missense unknown
R5428:Myt1l UTSW 12 29832332 missense unknown
R5429:Myt1l UTSW 12 29832332 missense unknown
R5431:Myt1l UTSW 12 29832332 missense unknown
R5926:Myt1l UTSW 12 29832332 missense unknown
R5959:Myt1l UTSW 12 29920040 critical splice donor site probably null
R6082:Myt1l UTSW 12 29832332 missense unknown
R6082:Myt1l UTSW 12 29842519 missense probably damaging 1.00
R6084:Myt1l UTSW 12 29832332 missense unknown
R6086:Myt1l UTSW 12 29832332 missense unknown
R6145:Myt1l UTSW 12 29832381 missense unknown
R6293:Myt1l UTSW 12 29827628 missense unknown
R6315:Myt1l UTSW 12 29827798 missense unknown
R6458:Myt1l UTSW 12 29895299 missense unknown
R6490:Myt1l UTSW 12 29832366 missense unknown
R6758:Myt1l UTSW 12 29842600 missense possibly damaging 0.94
R7230:Myt1l UTSW 12 29783874 missense probably damaging 0.99
R7330:Myt1l UTSW 12 29851554 missense unknown
R7545:Myt1l UTSW 12 29827088 missense unknown
R7662:Myt1l UTSW 12 29826869 missense unknown
R7744:Myt1l UTSW 12 29827549 missense unknown
U24488:Myt1l UTSW 12 29826896 missense unknown
Z1177:Myt1l UTSW 12 29811431 missense probably damaging 1.00
Z1177:Myt1l UTSW 12 29842468 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCAAGCGAAAACCATTTG -3'
(R):5'- GTTCTGGAATTGTTAGGATGCCAC -3'

Sequencing Primer
(F):5'- GCAGTAAAAGCAGATAGTTCCTC -3'
(R):5'- TGTTAGGATGCCACGGATAATAACAC -3'
Posted On2016-11-08