Incidental Mutation 'R5629:Skint6'
ID 441968
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 043280-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5629 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 112870176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 594 (T594I)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: T594I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: T594I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: T594I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: T594I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 36,014,507 (GRCm39) D189N probably benign Het
Adamts9 A T 6: 92,775,114 (GRCm39) V1052D probably damaging Het
Apob T C 12: 8,057,847 (GRCm39) Y2077H probably damaging Het
Apol7e A T 15: 77,602,276 (GRCm39) K291N probably benign Het
Arsk A T 13: 76,242,027 (GRCm39) I82N probably damaging Het
Art1 A G 7: 101,756,286 (GRCm39) Q159R probably benign Het
Atp2a2 A G 5: 122,598,159 (GRCm39) V733A probably damaging Het
Btn2a2 A T 13: 23,666,130 (GRCm39) probably null Het
Catsper1 C T 19: 5,386,165 (GRCm39) P133S probably benign Het
Celsr3 A G 9: 108,726,266 (GRCm39) D3165G probably benign Het
Cldn19 T A 4: 119,114,116 (GRCm39) V86E probably damaging Het
Ctnna1 T A 18: 35,382,802 (GRCm39) D649E probably benign Het
Cttnbp2 A G 6: 18,405,217 (GRCm39) I1094T probably damaging Het
Ddx24 T C 12: 103,391,806 (GRCm39) probably benign Het
Ern2 T A 7: 121,769,389 (GRCm39) H879L probably damaging Het
Etv4 T A 11: 101,662,751 (GRCm39) H277L probably damaging Het
Faap100 G T 11: 120,267,837 (GRCm39) A312D probably damaging Het
Glipr1l1 G A 10: 111,914,308 (GRCm39) C223Y possibly damaging Het
Gna14 T C 19: 16,414,097 (GRCm39) S14P possibly damaging Het
Hapln1 A G 13: 89,749,634 (GRCm39) T60A probably damaging Het
Hars2 T A 18: 36,921,719 (GRCm39) Y273* probably null Het
Ighv5-6 A T 12: 113,589,242 (GRCm39) Y79* probably null Het
Iqgap2 T A 13: 95,768,682 (GRCm39) N1406I probably damaging Het
Kalrn T C 16: 33,860,304 (GRCm39) T215A possibly damaging Het
Krtap13-1 T A 16: 88,526,047 (GRCm39) S90R probably benign Het
Mettl8 T C 2: 70,795,913 (GRCm39) I372V probably benign Het
Mfn1 A T 3: 32,615,659 (GRCm39) T341S possibly damaging Het
Mocos T A 18: 24,797,142 (GRCm39) probably null Het
Muc5b T C 7: 141,415,036 (GRCm39) S2661P possibly damaging Het
Myo15a C T 11: 60,370,578 (GRCm39) P1113S probably benign Het
Myo5a A T 9: 75,111,127 (GRCm39) I1540F possibly damaging Het
Myoc T C 1: 162,476,156 (GRCm39) Y287H probably damaging Het
Napepld A G 5: 21,880,901 (GRCm39) F165L probably benign Het
Ndufb10 T C 17: 24,941,656 (GRCm39) E102G probably damaging Het
Nrros T A 16: 31,963,223 (GRCm39) I265F probably damaging Het
Nrxn1 A T 17: 90,897,460 (GRCm39) F891I possibly damaging Het
Nsfl1c T C 2: 151,346,085 (GRCm39) Y169H probably damaging Het
Oas2 G A 5: 120,876,516 (GRCm39) Q476* probably null Het
Or51f5 A T 7: 102,423,847 (GRCm39) I39F possibly damaging Het
Pcnx2 C A 8: 126,624,780 (GRCm39) W14L probably damaging Het
Pip4p1 T C 14: 51,165,373 (GRCm39) H278R probably benign Het
Piwil2 C T 14: 70,660,416 (GRCm39) V70M probably damaging Het
Prss23 A C 7: 89,159,400 (GRCm39) V223G probably damaging Het
Rarres2 A T 6: 48,547,194 (GRCm39) L122Q probably benign Het
Robo1 T C 16: 72,780,598 (GRCm39) V776A probably benign Het
Robo3 G A 9: 37,330,507 (GRCm39) Q1008* probably null Het
Robo4 G A 9: 37,319,658 (GRCm39) C636Y probably damaging Het
Sacm1l A G 9: 123,395,464 (GRCm39) M196V probably benign Het
Septin7 T A 9: 25,199,589 (GRCm39) Y163N probably damaging Het
Slc23a1 T C 18: 35,759,545 (GRCm39) H13R probably benign Het
Slc25a39 A C 11: 102,295,719 (GRCm39) Y109* probably null Het
Slc8a3 G A 12: 81,246,405 (GRCm39) R883C probably damaging Het
Spag17 A T 3: 99,987,435 (GRCm39) Y1575F probably benign Het
Spdye4c T A 2: 128,438,705 (GRCm39) I321N probably damaging Het
Stk32b G A 5: 37,614,576 (GRCm39) P311S probably damaging Het
Svs3a T A 2: 164,132,040 (GRCm39) S203T probably benign Het
Taf3 A T 2: 9,922,989 (GRCm39) I45N probably damaging Het
Taf7 T C 18: 37,776,555 (GRCm39) N4S probably benign Het
Tial1 T A 7: 128,046,421 (GRCm39) D87V probably damaging Het
Tmem120a T A 5: 135,770,904 (GRCm39) E78V probably benign Het
Tmem19 A G 10: 115,183,165 (GRCm39) F137L probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trim30d T C 7: 104,137,136 (GRCm39) K23E possibly damaging Het
Ubxn7 C A 16: 32,151,117 (GRCm39) H4Q unknown Het
Usp40 C T 1: 87,908,731 (GRCm39) R590H probably benign Het
Vmn1r90 A G 7: 14,296,011 (GRCm39) M22T possibly damaging Het
Vmn2r1 G A 3: 64,012,538 (GRCm39) V800M possibly damaging Het
Vps11 A T 9: 44,267,673 (GRCm39) I313N probably damaging Het
Zhx1 A G 15: 57,918,207 (GRCm39) V13A probably damaging Het
Zic4 G A 9: 91,260,805 (GRCm39) R20H probably benign Het
Zp3r C T 1: 130,510,616 (GRCm39) V369M probably damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCATAGCAGCTAGGGATACAGTG -3'
(R):5'- TCATCCCCACATGTGATGTATATG -3'

Sequencing Primer
(F):5'- GGATACAGTGGCATCATGAAAATCCC -3'
(R):5'- CCACATGTGATGTATATGGGCCAC -3'
Posted On 2016-11-08