Incidental Mutation 'R5629:Art1'
ID441984
Institutional Source Beutler Lab
Gene Symbol Art1
Ensembl Gene ENSMUSG00000030996
Gene NameADP-ribosyltransferase 1
SynonymsADPRT, Yac-1
MMRRC Submission 043280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5629 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102101743-102113933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102107079 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 159 (Q159R)
Ref Sequence ENSEMBL: ENSMUSP00000147911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084830] [ENSMUST00000094128] [ENSMUST00000209809] [ENSMUST00000210211]
Predicted Effect probably benign
Transcript: ENSMUST00000033300
AA Change: Q159R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996
AA Change: Q159R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084830
SMART Domains Protein: ENSMUSP00000081891
Gene: ENSMUSG00000066279

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 30 236 1.5e-67 PFAM
Pfam:Neur_chan_memb 243 384 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209809
AA Change: Q159R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,857,163 D189N probably benign Het
Adamts9 A T 6: 92,798,133 V1052D probably damaging Het
Apob T C 12: 8,007,847 Y2077H probably damaging Het
Apol7e A T 15: 77,718,076 K291N probably benign Het
Arsk A T 13: 76,093,908 I82N probably damaging Het
Atp2a2 A G 5: 122,460,096 V733A probably damaging Het
Btn2a2 A T 13: 23,481,960 probably null Het
Catsper1 C T 19: 5,336,137 P133S probably benign Het
Celsr3 A G 9: 108,849,067 D3165G probably benign Het
Cldn19 T A 4: 119,256,919 V86E probably damaging Het
Ctnna1 T A 18: 35,249,749 D649E probably benign Het
Cttnbp2 A G 6: 18,405,218 I1094T probably damaging Het
Ddx24 T C 12: 103,425,547 probably benign Het
Ern2 T A 7: 122,170,166 H879L probably damaging Het
Etv4 T A 11: 101,771,925 H277L probably damaging Het
Faap100 G T 11: 120,377,011 A312D probably damaging Het
Glipr1l1 G A 10: 112,078,403 C223Y possibly damaging Het
Gna14 T C 19: 16,436,733 S14P possibly damaging Het
Hapln1 A G 13: 89,601,515 T60A probably damaging Het
Hars2 T A 18: 36,788,666 Y273* probably null Het
Ighv5-6 A T 12: 113,625,622 Y79* probably null Het
Iqgap2 T A 13: 95,632,174 N1406I probably damaging Het
Kalrn T C 16: 34,039,934 T215A possibly damaging Het
Krtap13-1 T A 16: 88,729,159 S90R probably benign Het
Mettl8 T C 2: 70,965,569 I372V probably benign Het
Mfn1 A T 3: 32,561,510 T341S possibly damaging Het
Mocos T A 18: 24,664,085 probably null Het
Muc5b T C 7: 141,861,299 S2661P possibly damaging Het
Myo15 C T 11: 60,479,752 P1113S probably benign Het
Myo5a A T 9: 75,203,845 I1540F possibly damaging Het
Myoc T C 1: 162,648,587 Y287H probably damaging Het
Napepld A G 5: 21,675,903 F165L probably benign Het
Ndufb10 T C 17: 24,722,682 E102G probably damaging Het
Nrros T A 16: 32,144,405 I265F probably damaging Het
Nrxn1 A T 17: 90,590,032 F891I possibly damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Oas2 G A 5: 120,738,451 Q476* probably null Het
Olfr561 A T 7: 102,774,640 I39F possibly damaging Het
Pcnx2 C A 8: 125,898,041 W14L probably damaging Het
Piwil2 C T 14: 70,422,967 V70M probably damaging Het
Prss23 A C 7: 89,510,192 V223G probably damaging Het
Rarres2 A T 6: 48,570,260 L122Q probably benign Het
Robo1 T C 16: 72,983,710 V776A probably benign Het
Robo3 G A 9: 37,419,211 Q1008* probably null Het
Robo4 G A 9: 37,408,362 C636Y probably damaging Het
Sacm1l A G 9: 123,566,399 M196V probably benign Het
Sept7 T A 9: 25,288,293 Y163N probably damaging Het
Skint6 G A 4: 113,012,979 T594I possibly damaging Het
Slc23a1 T C 18: 35,626,492 H13R probably benign Het
Slc25a39 A C 11: 102,404,893 Y109* probably null Het
Slc8a3 G A 12: 81,199,631 R883C probably damaging Het
Spag17 A T 3: 100,080,119 Y1575F probably benign Het
Spdye4c T A 2: 128,596,785 I321N probably damaging Het
Stk32b G A 5: 37,457,232 P311S probably damaging Het
Svs3a T A 2: 164,290,120 S203T probably benign Het
Taf3 A T 2: 9,918,178 I45N probably damaging Het
Taf7 T C 18: 37,643,502 N4S probably benign Het
Tial1 T A 7: 128,444,697 D87V probably damaging Het
Tmem120a T A 5: 135,742,050 E78V probably benign Het
Tmem19 A G 10: 115,347,260 F137L probably benign Het
Tmem55b T C 14: 50,927,916 H278R probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trim30d T C 7: 104,487,929 K23E possibly damaging Het
Ubxn7 C A 16: 32,332,299 H4Q unknown Het
Usp40 C T 1: 87,981,009 R590H probably benign Het
Vmn1r90 A G 7: 14,562,086 M22T possibly damaging Het
Vmn2r1 G A 3: 64,105,117 V800M possibly damaging Het
Vps11 A T 9: 44,356,376 I313N probably damaging Het
Zhx1 A G 15: 58,054,811 V13A probably damaging Het
Zic4 G A 9: 91,378,752 R20H probably benign Het
Zp3r C T 1: 130,582,879 V369M probably damaging Het
Other mutations in Art1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Art1 APN 7 102110748 missense probably damaging 0.97
IGL03238:Art1 APN 7 102110749 missense possibly damaging 0.46
R0885:Art1 UTSW 7 102107334 missense probably damaging 1.00
R1343:Art1 UTSW 7 102106953 missense probably damaging 1.00
R1348:Art1 UTSW 7 102107372 missense possibly damaging 0.55
R2167:Art1 UTSW 7 102106824 missense probably damaging 0.99
R4637:Art1 UTSW 7 102106337 missense probably damaging 0.96
R4821:Art1 UTSW 7 102107178 missense probably damaging 1.00
R6150:Art1 UTSW 7 102107087 missense probably benign
R6936:Art1 UTSW 7 102106770 missense possibly damaging 0.58
R7304:Art1 UTSW 7 102106324 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CAACAATCAGTGGCAGGAGC -3'
(R):5'- ATACCGAAGAAGGTGTCCTCG -3'

Sequencing Primer
(F):5'- CCGTGTGGGGCTCCTTG -3'
(R):5'- AAGGTGTCCTCGCCAAATTG -3'
Posted On2016-11-08