Incidental Mutation 'R5629:Slc8a3'
ID442007
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
MMRRC Submission 043280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5629 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81199631 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 883 (R883C)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]
Predicted Effect probably damaging
Transcript: ENSMUST00000064594
AA Change: R882C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: R882C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: R876C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: R876C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: R883C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: R883C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182366
SMART Domains Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
PDB:2LT9|A 1 52 2e-28 PDB
low complexity region 82 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,857,163 D189N probably benign Het
Adamts9 A T 6: 92,798,133 V1052D probably damaging Het
Apob T C 12: 8,007,847 Y2077H probably damaging Het
Apol7e A T 15: 77,718,076 K291N probably benign Het
Arsk A T 13: 76,093,908 I82N probably damaging Het
Art1 A G 7: 102,107,079 Q159R probably benign Het
Atp2a2 A G 5: 122,460,096 V733A probably damaging Het
Btn2a2 A T 13: 23,481,960 probably null Het
Catsper1 C T 19: 5,336,137 P133S probably benign Het
Celsr3 A G 9: 108,849,067 D3165G probably benign Het
Cldn19 T A 4: 119,256,919 V86E probably damaging Het
Ctnna1 T A 18: 35,249,749 D649E probably benign Het
Cttnbp2 A G 6: 18,405,218 I1094T probably damaging Het
Ddx24 T C 12: 103,425,547 probably benign Het
Ern2 T A 7: 122,170,166 H879L probably damaging Het
Etv4 T A 11: 101,771,925 H277L probably damaging Het
Faap100 G T 11: 120,377,011 A312D probably damaging Het
Glipr1l1 G A 10: 112,078,403 C223Y possibly damaging Het
Gna14 T C 19: 16,436,733 S14P possibly damaging Het
Hapln1 A G 13: 89,601,515 T60A probably damaging Het
Hars2 T A 18: 36,788,666 Y273* probably null Het
Ighv5-6 A T 12: 113,625,622 Y79* probably null Het
Iqgap2 T A 13: 95,632,174 N1406I probably damaging Het
Kalrn T C 16: 34,039,934 T215A possibly damaging Het
Krtap13-1 T A 16: 88,729,159 S90R probably benign Het
Mettl8 T C 2: 70,965,569 I372V probably benign Het
Mfn1 A T 3: 32,561,510 T341S possibly damaging Het
Mocos T A 18: 24,664,085 probably null Het
Muc5b T C 7: 141,861,299 S2661P possibly damaging Het
Myo15 C T 11: 60,479,752 P1113S probably benign Het
Myo5a A T 9: 75,203,845 I1540F possibly damaging Het
Myoc T C 1: 162,648,587 Y287H probably damaging Het
Napepld A G 5: 21,675,903 F165L probably benign Het
Ndufb10 T C 17: 24,722,682 E102G probably damaging Het
Nrros T A 16: 32,144,405 I265F probably damaging Het
Nrxn1 A T 17: 90,590,032 F891I possibly damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Oas2 G A 5: 120,738,451 Q476* probably null Het
Olfr561 A T 7: 102,774,640 I39F possibly damaging Het
Pcnx2 C A 8: 125,898,041 W14L probably damaging Het
Piwil2 C T 14: 70,422,967 V70M probably damaging Het
Prss23 A C 7: 89,510,192 V223G probably damaging Het
Rarres2 A T 6: 48,570,260 L122Q probably benign Het
Robo1 T C 16: 72,983,710 V776A probably benign Het
Robo3 G A 9: 37,419,211 Q1008* probably null Het
Robo4 G A 9: 37,408,362 C636Y probably damaging Het
Sacm1l A G 9: 123,566,399 M196V probably benign Het
Sept7 T A 9: 25,288,293 Y163N probably damaging Het
Skint6 G A 4: 113,012,979 T594I possibly damaging Het
Slc23a1 T C 18: 35,626,492 H13R probably benign Het
Slc25a39 A C 11: 102,404,893 Y109* probably null Het
Spag17 A T 3: 100,080,119 Y1575F probably benign Het
Spdye4c T A 2: 128,596,785 I321N probably damaging Het
Stk32b G A 5: 37,457,232 P311S probably damaging Het
Svs3a T A 2: 164,290,120 S203T probably benign Het
Taf3 A T 2: 9,918,178 I45N probably damaging Het
Taf7 T C 18: 37,643,502 N4S probably benign Het
Tial1 T A 7: 128,444,697 D87V probably damaging Het
Tmem120a T A 5: 135,742,050 E78V probably benign Het
Tmem19 A G 10: 115,347,260 F137L probably benign Het
Tmem55b T C 14: 50,927,916 H278R probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trim30d T C 7: 104,487,929 K23E possibly damaging Het
Ubxn7 C A 16: 32,332,299 H4Q unknown Het
Usp40 C T 1: 87,981,009 R590H probably benign Het
Vmn1r90 A G 7: 14,562,086 M22T possibly damaging Het
Vmn2r1 G A 3: 64,105,117 V800M possibly damaging Het
Vps11 A T 9: 44,356,376 I313N probably damaging Het
Zhx1 A G 15: 58,054,811 V13A probably damaging Het
Zic4 G A 9: 91,378,752 R20H probably benign Het
Zp3r C T 1: 130,582,879 V369M probably damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R6062:Slc8a3 UTSW 12 81314350 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6279:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7960:Slc8a3 UTSW 12 81216732 missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81202258 missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81199681 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81315140 missense probably benign
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGCGTCCTTCTCTCAGGAG -3'
(R):5'- ACGTGTATGCAGATGCTTCC -3'

Sequencing Primer
(F):5'- TCTCTCAGGAGAAGTCCCAG -3'
(R):5'- AGATGCTTCCATTGGCAACG -3'
Posted On2016-11-08