Incidental Mutation 'R5629:Arsk'
ID442011
Institutional Source Beutler Lab
Gene Symbol Arsk
Ensembl Gene ENSMUSG00000021592
Gene Namearylsulfatase K
Synonyms
MMRRC Submission 043280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5629 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location76060422-76098660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76093908 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 82 (I82N)
Ref Sequence ENSEMBL: ENSMUSP00000113274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000120573] [ENSMUST00000223579] [ENSMUST00000224386]
Predicted Effect probably benign
Transcript: ENSMUST00000091466
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120573
AA Change: I82N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113274
Gene: ENSMUSG00000021592
AA Change: I82N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sulfatase 35 371 6e-49 PFAM
low complexity region 381 392 N/A INTRINSIC
low complexity region 537 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123282
Predicted Effect probably benign
Transcript: ENSMUST00000223579
Predicted Effect probably benign
Transcript: ENSMUST00000224386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224884
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSK, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,857,163 D189N probably benign Het
Adamts9 A T 6: 92,798,133 V1052D probably damaging Het
Apob T C 12: 8,007,847 Y2077H probably damaging Het
Apol7e A T 15: 77,718,076 K291N probably benign Het
Art1 A G 7: 102,107,079 Q159R probably benign Het
Atp2a2 A G 5: 122,460,096 V733A probably damaging Het
Btn2a2 A T 13: 23,481,960 probably null Het
Catsper1 C T 19: 5,336,137 P133S probably benign Het
Celsr3 A G 9: 108,849,067 D3165G probably benign Het
Cldn19 T A 4: 119,256,919 V86E probably damaging Het
Ctnna1 T A 18: 35,249,749 D649E probably benign Het
Cttnbp2 A G 6: 18,405,218 I1094T probably damaging Het
Ddx24 T C 12: 103,425,547 probably benign Het
Ern2 T A 7: 122,170,166 H879L probably damaging Het
Etv4 T A 11: 101,771,925 H277L probably damaging Het
Faap100 G T 11: 120,377,011 A312D probably damaging Het
Glipr1l1 G A 10: 112,078,403 C223Y possibly damaging Het
Gna14 T C 19: 16,436,733 S14P possibly damaging Het
Hapln1 A G 13: 89,601,515 T60A probably damaging Het
Hars2 T A 18: 36,788,666 Y273* probably null Het
Ighv5-6 A T 12: 113,625,622 Y79* probably null Het
Iqgap2 T A 13: 95,632,174 N1406I probably damaging Het
Kalrn T C 16: 34,039,934 T215A possibly damaging Het
Krtap13-1 T A 16: 88,729,159 S90R probably benign Het
Mettl8 T C 2: 70,965,569 I372V probably benign Het
Mfn1 A T 3: 32,561,510 T341S possibly damaging Het
Mocos T A 18: 24,664,085 probably null Het
Muc5b T C 7: 141,861,299 S2661P possibly damaging Het
Myo15 C T 11: 60,479,752 P1113S probably benign Het
Myo5a A T 9: 75,203,845 I1540F possibly damaging Het
Myoc T C 1: 162,648,587 Y287H probably damaging Het
Napepld A G 5: 21,675,903 F165L probably benign Het
Ndufb10 T C 17: 24,722,682 E102G probably damaging Het
Nrros T A 16: 32,144,405 I265F probably damaging Het
Nrxn1 A T 17: 90,590,032 F891I possibly damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Oas2 G A 5: 120,738,451 Q476* probably null Het
Olfr561 A T 7: 102,774,640 I39F possibly damaging Het
Pcnx2 C A 8: 125,898,041 W14L probably damaging Het
Piwil2 C T 14: 70,422,967 V70M probably damaging Het
Prss23 A C 7: 89,510,192 V223G probably damaging Het
Rarres2 A T 6: 48,570,260 L122Q probably benign Het
Robo1 T C 16: 72,983,710 V776A probably benign Het
Robo3 G A 9: 37,419,211 Q1008* probably null Het
Robo4 G A 9: 37,408,362 C636Y probably damaging Het
Sacm1l A G 9: 123,566,399 M196V probably benign Het
Sept7 T A 9: 25,288,293 Y163N probably damaging Het
Skint6 G A 4: 113,012,979 T594I possibly damaging Het
Slc23a1 T C 18: 35,626,492 H13R probably benign Het
Slc25a39 A C 11: 102,404,893 Y109* probably null Het
Slc8a3 G A 12: 81,199,631 R883C probably damaging Het
Spag17 A T 3: 100,080,119 Y1575F probably benign Het
Spdye4c T A 2: 128,596,785 I321N probably damaging Het
Stk32b G A 5: 37,457,232 P311S probably damaging Het
Svs3a T A 2: 164,290,120 S203T probably benign Het
Taf3 A T 2: 9,918,178 I45N probably damaging Het
Taf7 T C 18: 37,643,502 N4S probably benign Het
Tial1 T A 7: 128,444,697 D87V probably damaging Het
Tmem120a T A 5: 135,742,050 E78V probably benign Het
Tmem19 A G 10: 115,347,260 F137L probably benign Het
Tmem55b T C 14: 50,927,916 H278R probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trim30d T C 7: 104,487,929 K23E possibly damaging Het
Ubxn7 C A 16: 32,332,299 H4Q unknown Het
Usp40 C T 1: 87,981,009 R590H probably benign Het
Vmn1r90 A G 7: 14,562,086 M22T possibly damaging Het
Vmn2r1 G A 3: 64,105,117 V800M possibly damaging Het
Vps11 A T 9: 44,356,376 I313N probably damaging Het
Zhx1 A G 15: 58,054,811 V13A probably damaging Het
Zic4 G A 9: 91,378,752 R20H probably benign Het
Zp3r C T 1: 130,582,879 V369M probably damaging Het
Other mutations in Arsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Arsk APN 13 76098368 splice site probably null
IGL02537:Arsk APN 13 76074906 nonsense probably null
IGL02691:Arsk APN 13 76074950 missense probably damaging 0.98
IGL03038:Arsk APN 13 76065513 splice site probably benign
PIT4480001:Arsk UTSW 13 76062365 missense probably damaging 1.00
R0277:Arsk UTSW 13 76074932 missense probably benign 0.01
R0900:Arsk UTSW 13 76098457 unclassified probably benign
R1441:Arsk UTSW 13 76074964 missense probably benign 0.01
R1748:Arsk UTSW 13 76062410 missense probably benign 0.15
R1923:Arsk UTSW 13 76066866 splice site probably benign
R2131:Arsk UTSW 13 76091812 nonsense probably null
R3723:Arsk UTSW 13 76066653 missense probably damaging 0.98
R4088:Arsk UTSW 13 76098414 missense probably benign
R4851:Arsk UTSW 13 76065279 critical splice donor site probably null
R5406:Arsk UTSW 13 76093947 missense probably benign
R5869:Arsk UTSW 13 76091784 missense probably benign 0.29
R6217:Arsk UTSW 13 76091816 missense unknown
R6552:Arsk UTSW 13 76072196 missense probably damaging 0.99
R6560:Arsk UTSW 13 76074986 missense probably benign 0.33
R6726:Arsk UTSW 13 76074788 missense probably damaging 1.00
R7421:Arsk UTSW 13 76062515 missense possibly damaging 0.81
R8178:Arsk UTSW 13 76091742 missense probably damaging 1.00
R8274:Arsk UTSW 13 76072184 missense probably damaging 1.00
X0050:Arsk UTSW 13 76065280 missense probably null 0.78
X0066:Arsk UTSW 13 76062456 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGCCCAACATTCAACCTATCTTAG -3'
(R):5'- GAACAAACATCCTGAAGTCTTTTGGG -3'

Sequencing Primer
(F):5'- TTCAACCTATCTTAGAACACACCAG -3'
(R):5'- TGAAGTCTTTTGGGTTGTAAATTTTG -3'
Posted On2016-11-08