Incidental Mutation 'R5630:Upf2'
ID442036
Institutional Source Beutler Lab
Gene Symbol Upf2
Ensembl Gene ENSMUSG00000043241
Gene NameUPF2 regulator of nonsense transcripts homolog (yeast)
Synonyms
MMRRC Submission 043281-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5630 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location5951469-6056703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6027301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 141 (V141A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060092]
Predicted Effect unknown
Transcript: ENSMUST00000060092
AA Change: V886A
SMART Domains Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241
AA Change: V886A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 54 125 N/A INTRINSIC
MIF4G 167 363 1.22e-32 SMART
coiled coil region 514 543 N/A INTRINSIC
MIF4G 567 756 1.13e-50 SMART
MIF4G 771 984 3.43e-50 SMART
low complexity region 1023 1042 N/A INTRINSIC
Pfam:Upf2 1051 1215 1.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128200
AA Change: V141A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119348
Gene: ENSMUSG00000043241
AA Change: V141A

DomainStartEndE-ValueType
MIF4G 27 240 3.43e-50 SMART
low complexity region 279 298 N/A INTRINSIC
Pfam:Upf2 304 469 3.1e-44 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s2 A T 7: 79,909,899 V94E probably damaging Het
Aven T A 2: 112,514,545 Y109* probably null Het
Cad T C 5: 31,060,573 S401P probably damaging Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cntnap5b A G 1: 100,072,069 D184G probably damaging Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcmt1 A G 10: 7,649,093 Y84H probably damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Rrp8 C A 7: 105,733,401 R448L possibly damaging Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Szt2 T C 4: 118,392,905 I469V possibly damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Upf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Upf2 APN 2 5961300 missense unknown
IGL01394:Upf2 APN 2 6040213 splice site probably null
IGL01571:Upf2 APN 2 6018939 unclassified probably benign
IGL01624:Upf2 APN 2 6034179 missense probably benign
IGL02121:Upf2 APN 2 6026323 splice site probably benign
IGL02485:Upf2 APN 2 6027291 missense unknown
IGL02491:Upf2 APN 2 6026164 missense unknown
R0265:Upf2 UTSW 2 6027204 splice site probably benign
R0390:Upf2 UTSW 2 6018894 unclassified probably benign
R0480:Upf2 UTSW 2 5957634 missense possibly damaging 0.71
R0513:Upf2 UTSW 2 5957667 missense unknown
R0579:Upf2 UTSW 2 5988429 missense unknown
R0612:Upf2 UTSW 2 6034098 splice site probably benign
R0856:Upf2 UTSW 2 5957652 missense unknown
R1103:Upf2 UTSW 2 6026175 missense unknown
R1384:Upf2 UTSW 2 5960989 missense unknown
R1672:Upf2 UTSW 2 6040097 splice site probably null
R1728:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1784:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1836:Upf2 UTSW 2 6050324 splice site probably null
R2252:Upf2 UTSW 2 5961460 missense unknown
R2339:Upf2 UTSW 2 6040102 splice site probably benign
R3015:Upf2 UTSW 2 5976079 missense unknown
R3931:Upf2 UTSW 2 6047010 missense unknown
R4151:Upf2 UTSW 2 5961705 missense unknown
R4283:Upf2 UTSW 2 5973558 missense unknown
R4558:Upf2 UTSW 2 5973593 missense unknown
R4564:Upf2 UTSW 2 6027312 missense unknown
R6370:Upf2 UTSW 2 5976010 missense unknown
R6418:Upf2 UTSW 2 6027339 missense unknown
R6432:Upf2 UTSW 2 5979777 missense unknown
R7184:Upf2 UTSW 2 6023320 missense unknown
R7308:Upf2 UTSW 2 5973518 missense unknown
R7371:Upf2 UTSW 2 5961040 missense unknown
R7404:Upf2 UTSW 2 6040203 missense unknown
R7439:Upf2 UTSW 2 6018932 missense unknown
R7441:Upf2 UTSW 2 6018932 missense unknown
R7461:Upf2 UTSW 2 5973536 missense unknown
R7483:Upf2 UTSW 2 6027408 missense unknown
R7613:Upf2 UTSW 2 5973536 missense unknown
R7976:Upf2 UTSW 2 6026115 missense unknown
R8044:Upf2 UTSW 2 6029438 missense unknown
Z1176:Upf2 UTSW 2 6023388 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACAGGCTAATTAGAAATAGCCAC -3'
(R):5'- GAAGCAGTCAAGTTTTCGTTTACTGG -3'

Sequencing Primer
(F):5'- TCTGACAGATGCTCTTTGACTAG -3'
(R):5'- CTGGAACCTCTGTCAAAGTACTGG -3'
Posted On2016-11-08