Incidental Mutation 'R5630:Szt2'
ID 442046
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name seizure threshold 2
Synonyms
MMRRC Submission 043281-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.591) question?
Stock # R5630 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118362743-118409273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118392905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 469 (I469V)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000075406
AA Change: I469V

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: I469V

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136737
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s2 A T 7: 79,909,899 V94E probably damaging Het
Aven T A 2: 112,514,545 Y109* probably null Het
Cad T C 5: 31,060,573 S401P probably damaging Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cntnap5b A G 1: 100,072,069 D184G probably damaging Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcmt1 A G 10: 7,649,093 Y84H probably damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Rrp8 C A 7: 105,733,401 R448L possibly damaging Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Upf2 T C 2: 6,027,301 V141A probably damaging Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
R7833:Szt2 UTSW 4 118366219 missense unknown
R7896:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118373840 missense unknown
R8090:Szt2 UTSW 4 118387002 splice site probably null
R8103:Szt2 UTSW 4 118387864 missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118389776 missense probably damaging 0.96
R8309:Szt2 UTSW 4 118375482 frame shift probably null
R8341:Szt2 UTSW 4 118392836 missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118386818 missense probably benign 0.01
R8497:Szt2 UTSW 4 118388321 missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118372681 missense unknown
R8768:Szt2 UTSW 4 118369416 missense unknown
R8992:Szt2 UTSW 4 118382788 splice site probably benign
R9001:Szt2 UTSW 4 118378332 missense unknown
R9094:Szt2 UTSW 4 118385454 missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118385433 missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118364669 missense unknown
R9184:Szt2 UTSW 4 118384529 missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118385091 missense probably damaging 1.00
R9424:Szt2 UTSW 4 118390954 missense probably damaging 1.00
R9598:Szt2 UTSW 4 118409161 critical splice donor site probably null
X0023:Szt2 UTSW 4 118372404 missense unknown
Z1176:Szt2 UTSW 4 118393976 missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118391214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAACAAGGGCCAAGCTTG -3'
(R):5'- TGACACATGAGGAGGACTCTGG -3'

Sequencing Primer
(F):5'- GCTTGAGCTACAGCAGGCTG -3'
(R):5'- GCCTGGAGTCCTGCTTCTTCTAAG -3'
Posted On 2016-11-08