Incidental Mutation 'R5630:Cad'
ID442047
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
MMRRC Submission 043281-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5630 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31060573 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 401 (S401P)
Ref Sequence ENSEMBL: ENSMUSP00000144009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000201838] [ENSMUST00000202795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013773
AA Change: S401P

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: S401P

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031049
AA Change: S401P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031049
Gene: ENSMUSG00000013629
AA Change: S401P

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 3.8e-48 PFAM
Pfam:CPSase_L_chain 392 509 2.1e-20 PFAM
Pfam:CPSase_L_D2 514 616 1.9e-34 PFAM
Pfam:ATP-grasp 522 626 1.7e-6 PFAM
Pfam:Dala_Dala_lig_C 524 624 2.7e-7 PFAM
Pfam:CPSase_L_D2 614 655 5.2e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:CPSase_L_chain 868 979 2.9e-20 PFAM
Pfam:ATP-grasp_4 981 1160 6.4e-24 PFAM
Pfam:CPSase_L_D2 984 1187 3.5e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 1.2e-6 PFAM
Pfam:ATP-grasp 992 1159 1.6e-11 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_5 1374 1437 9.4e-7 PFAM
Pfam:Amidohydro_1 1399 1597 1.9e-12 PFAM
Pfam:Amidohydro_4 1401 1692 5.5e-15 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2003 1.7e-48 PFAM
Pfam:OTCace 2008 2158 1.5e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200953
AA Change: S401P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: S401P

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000201182
AA Change: S401P

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: S401P

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201838
AA Change: S401P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629
AA Change: S401P

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 6.3e-48 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 3.7e-86 PFAM
Pfam:ATP-grasp 522 690 2.5e-10 PFAM
Pfam:Dala_Dala_lig_C 526 687 4.2e-11 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
SCOP:d1a9xa3 935 964 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201844
Predicted Effect probably damaging
Transcript: ENSMUST00000202795
AA Change: S401P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: S401P

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202967
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s2 A T 7: 79,909,899 V94E probably damaging Het
Aven T A 2: 112,514,545 Y109* probably null Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cntnap5b A G 1: 100,072,069 D184G probably damaging Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcmt1 A G 10: 7,649,093 Y84H probably damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Rrp8 C A 7: 105,733,401 R448L possibly damaging Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Szt2 T C 4: 118,392,905 I469V possibly damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Upf2 T C 2: 6,027,301 V141A probably damaging Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
PIT4696001:Cad UTSW 5 31072094 missense probably damaging 0.99
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 intron probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
R7145:Cad UTSW 5 31067612 missense possibly damaging 0.89
R7303:Cad UTSW 5 31060213 critical splice donor site probably null
R7352:Cad UTSW 5 31058078 missense probably damaging 1.00
R7382:Cad UTSW 5 31075829 missense probably benign
R7387:Cad UTSW 5 31061940 missense probably damaging 1.00
R7455:Cad UTSW 5 31074162 missense probably damaging 0.99
R7596:Cad UTSW 5 31069048 missense probably benign
R7627:Cad UTSW 5 31060164 missense probably damaging 1.00
R7898:Cad UTSW 5 31061485 missense probably damaging 1.00
R8022:Cad UTSW 5 31068806 missense probably damaging 1.00
R8115:Cad UTSW 5 31060927 missense possibly damaging 0.82
RF001:Cad UTSW 5 31060212 critical splice donor site probably benign
RF012:Cad UTSW 5 31060212 critical splice donor site probably benign
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Z1177:Cad UTSW 5 31068421 missense probably damaging 1.00
Z1177:Cad UTSW 5 31075128 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCTCTGTGCTTGCCTGGAAG -3'
(R):5'- TCTACAGAAGACAGGACTTAGGCAC -3'

Sequencing Primer
(F):5'- CCTGGAAGTGAGGGTCTAGTAC -3'
(R):5'- GAAGACAGGACTTAGGCACTTCTTC -3'
Posted On2016-11-08