Incidental Mutation 'R5630:Ap3s2'
ID442053
Institutional Source Beutler Lab
Gene Symbol Ap3s2
Ensembl Gene ENSMUSG00000063801
Gene Nameadaptor-related protein complex 3, sigma 2 subunit
Synonymssigma 3B, [s]3B
MMRRC Submission 043281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5630 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79875325-79920649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79909899 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 94 (V94E)
Ref Sequence ENSEMBL: ENSMUSP00000075082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075657] [ENSMUST00000206725]
Predicted Effect probably damaging
Transcript: ENSMUST00000075657
AA Change: V94E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075082
Gene: ENSMUSG00000063801
AA Change: V94E

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 9.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206725
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aven T A 2: 112,514,545 Y109* probably null Het
Cad T C 5: 31,060,573 S401P probably damaging Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cntnap5b A G 1: 100,072,069 D184G probably damaging Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcmt1 A G 10: 7,649,093 Y84H probably damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Rrp8 C A 7: 105,733,401 R448L possibly damaging Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Szt2 T C 4: 118,392,905 I469V possibly damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Upf2 T C 2: 6,027,301 V141A probably damaging Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Ap3s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ap3s2 APN 7 79916076 missense probably benign 0.35
R0138:Ap3s2 UTSW 7 79909869 missense probably benign 0.28
R0909:Ap3s2 UTSW 7 79880518 missense probably benign 0.01
R1711:Ap3s2 UTSW 7 79880490 missense probably damaging 0.98
R4909:Ap3s2 UTSW 7 79915241 missense possibly damaging 0.90
R5041:Ap3s2 UTSW 7 79920519 missense probably benign 0.07
R5528:Ap3s2 UTSW 7 79880486 makesense probably null
R6725:Ap3s2 UTSW 7 79920642 unclassified probably benign
R7473:Ap3s2 UTSW 7 79916031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACTCTTGAACTAGGTTGG -3'
(R):5'- TGCTGGGATTAAAGGTGTGCAC -3'

Sequencing Primer
(F):5'- GAACAAAAGAGCAAGTGAGAGAACC -3'
(R):5'- TTAAAGTGTTGGAGAAATGGTTCAG -3'
Posted On2016-11-08