Incidental Mutation 'R5630:Rrp8'
ID442054
Institutional Source Beutler Lab
Gene Symbol Rrp8
Ensembl Gene ENSMUSG00000030888
Gene Nameribosomal RNA processing 8, methyltransferase, homolog (yeast)
Synonyms
MMRRC Submission 043281-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R5630 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105731730-105737385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105733401 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 448 (R448L)
Ref Sequence ENSEMBL: ENSMUSP00000095752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033179
AA Change: R402L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888
AA Change: R402L

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098148
AA Change: R448L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888
AA Change: R448L

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127738
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148176
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154852
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s2 A T 7: 79,909,899 V94E probably damaging Het
Aven T A 2: 112,514,545 Y109* probably null Het
Cad T C 5: 31,060,573 S401P probably damaging Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cntnap5b A G 1: 100,072,069 D184G probably damaging Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcmt1 A G 10: 7,649,093 Y84H probably damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Szt2 T C 4: 118,392,905 I469V possibly damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Upf2 T C 2: 6,027,301 V141A probably damaging Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Rrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rrp8 APN 7 105733016 unclassified probably benign
IGL02792:Rrp8 APN 7 105733811 nonsense probably null
IGL03010:Rrp8 APN 7 105734391 missense probably benign 0.01
IGL03404:Rrp8 APN 7 105734938 missense probably benign 0.41
IGL03046:Rrp8 UTSW 7 105734902 missense probably benign 0.00
R0682:Rrp8 UTSW 7 105734011 missense probably damaging 0.97
R2314:Rrp8 UTSW 7 105734804 missense probably benign 0.37
R4222:Rrp8 UTSW 7 105734022 missense possibly damaging 0.86
R4778:Rrp8 UTSW 7 105737274 intron probably benign
R4940:Rrp8 UTSW 7 105734077 nonsense probably null
R5315:Rrp8 UTSW 7 105734000 missense probably benign 0.00
R5480:Rrp8 UTSW 7 105734129 missense probably damaging 1.00
R6266:Rrp8 UTSW 7 105736389 missense probably damaging 1.00
R6351:Rrp8 UTSW 7 105734809 missense probably damaging 0.99
R6353:Rrp8 UTSW 7 105734118 nonsense probably null
R7070:Rrp8 UTSW 7 105734876 missense possibly damaging 0.90
R7092:Rrp8 UTSW 7 105734109 missense probably damaging 1.00
R7632:Rrp8 UTSW 7 105736520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTCCCCTGCTCAGAGAG -3'
(R):5'- TGCCTTTCACTGATGGGAACTAAC -3'

Sequencing Primer
(F):5'- GAGAGCATCTCACAGCCCCTC -3'
(R):5'- GGAACTAACATCAGGGACTTCCTTG -3'
Posted On2016-11-08