Incidental Mutation 'R5630:Pcmt1'
ID442063
Institutional Source Beutler Lab
Gene Symbol Pcmt1
Ensembl Gene ENSMUSG00000019795
Gene Nameprotein-L-isoaspartate (D-aspartate) O-methyltransferase 1
SynonymsPIMT, protein carboxyl methyltransferase
MMRRC Submission 043281-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R5630 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location7629373-7681136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7649093 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 84 (Y84H)
Ref Sequence ENSEMBL: ENSMUSP00000125144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159917] [ENSMUST00000159977] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000162682] [ENSMUST00000163085]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159835
Predicted Effect probably damaging
Transcript: ENSMUST00000159917
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795
AA Change: Y98H

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159977
AA Change: Y9H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160517
Predicted Effect probably damaging
Transcript: ENSMUST00000161123
AA Change: Y85H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795
AA Change: Y85H

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161428
AA Change: Y21H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123758
Gene: ENSMUSG00000019795
AA Change: Y21H

DomainStartEndE-ValueType
Pfam:PCMT 1 160 2.7e-61 PFAM
Pfam:Ubie_methyltran 49 148 8.3e-7 PFAM
Pfam:Methyltransf_31 58 111 3.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162606
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795
AA Change: Y98H

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162682
AA Change: Y9H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795
AA Change: Y9H

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163085
AA Change: Y84H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795
AA Change: Y84H

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene causes accumulation of modified proteins, growth retardation and fatal epileptic seizures. Homozygotes for one null allele also show a small spleen, altered lipid, hormone, mineral and enzyme profiles, kyphosis, enlarged brain and abnormal dendritic arborizations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s2 A T 7: 79,909,899 V94E probably damaging Het
Aven T A 2: 112,514,545 Y109* probably null Het
Cad T C 5: 31,060,573 S401P probably damaging Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cntnap5b A G 1: 100,072,069 D184G probably damaging Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Rrp8 C A 7: 105,733,401 R448L possibly damaging Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Szt2 T C 4: 118,392,905 I469V possibly damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Upf2 T C 2: 6,027,301 V141A probably damaging Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Pcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02934:Pcmt1 APN 10 7640727 missense probably benign 0.00
R1968:Pcmt1 UTSW 10 7640710 nonsense probably null
R3889:Pcmt1 UTSW 10 7649050 critical splice donor site probably null
R5454:Pcmt1 UTSW 10 7640745 missense probably damaging 1.00
R5705:Pcmt1 UTSW 10 7638190 missense possibly damaging 0.86
R6667:Pcmt1 UTSW 10 7663149 missense probably damaging 1.00
R7163:Pcmt1 UTSW 10 7638158 missense probably benign 0.01
R7168:Pcmt1 UTSW 10 7638182 missense probably damaging 1.00
R7531:Pcmt1 UTSW 10 7680605 intron probably null
R8012:Pcmt1 UTSW 10 7640763 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAAGCATCCATGGGGCCAAC -3'
(R):5'- ATTGCCTGGATCATGGCAGG -3'

Sequencing Primer
(F):5'- GCAGAACCATCAATGACTTAGTTAC -3'
(R):5'- AGGCAGCGGTCTCGTCTG -3'
Posted On2016-11-08