Incidental Mutation 'R5653:Atp10d'
ID442096
Institutional Source Beutler Lab
Gene Symbol Atp10d
Ensembl Gene ENSMUSG00000046808
Gene NameATPase, class V, type 10D
SynonymsIMAGE:1069176, 9830145H18Rik, D5Buc24e
MMRRC Submission 043299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5653 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72203329-72298775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72264067 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 682 (Q682L)
Ref Sequence ENSEMBL: ENSMUSP00000143594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126664]
Predicted Effect probably benign
Transcript: ENSMUST00000126664
AA Change: Q682L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143594
Gene: ENSMUSG00000046808
AA Change: Q682L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 111 176 1.2e-21 PFAM
Pfam:E1-E2_ATPase 181 450 3e-10 PFAM
low complexity region 523 534 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Pfam:Cation_ATPase 739 859 3.4e-7 PFAM
Pfam:HAD 754 1114 1.3e-12 PFAM
Pfam:PhoLip_ATPase_C 1131 1376 4.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136350
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,883,412 L663P probably damaging Het
Atp8b1 A G 18: 64,545,197 V876A probably damaging Het
Bard1 A T 1: 71,031,429 V632E probably benign Het
Baz1b A T 5: 135,209,097 E209V probably benign Het
Bmp1 T A 14: 70,490,094 Y683F probably benign Het
Cacnb1 A T 11: 98,009,279 probably null Het
Capza2 G A 6: 17,654,113 A55T probably damaging Het
Cc2d2a A G 5: 43,722,462 N1127S possibly damaging Het
Ccdc13 A G 9: 121,798,787 *255R probably null Het
Ddias G T 7: 92,858,729 N659K probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dnah9 T C 11: 65,849,980 T4127A probably damaging Het
Dnajc10 T A 2: 80,349,368 Y749N probably damaging Het
Dnm1l A G 16: 16,319,489 L422P probably damaging Het
Edil3 A T 13: 89,131,812 N203I probably damaging Het
Egfr C T 11: 16,911,617 A1132V probably benign Het
Entpd7 C T 19: 43,691,157 R50* probably null Het
Fam160a1 A T 3: 85,722,501 L40Q probably damaging Het
Fat2 T C 11: 55,310,316 D644G probably damaging Het
Galnt11 T A 5: 25,248,858 D27E probably damaging Het
Gm10801 T A 2: 98,664,051 F158I probably damaging Het
Gm37240 A G 3: 84,497,795 F234L probably damaging Het
Gtf2ird1 A T 5: 134,410,967 F136L probably damaging Het
Hspa1l T C 17: 34,977,420 V145A probably damaging Het
Ice2 A G 9: 69,428,380 T882A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat6b A G 14: 21,669,372 N1264S probably benign Het
Kcnq4 C A 4: 120,702,411 V531L probably benign Het
Kif9 A T 9: 110,524,931 K790N probably damaging Het
Lipe T A 7: 25,398,408 I37L probably benign Het
Lrrc43 A G 5: 123,499,580 D270G probably damaging Het
Mon2 A G 10: 123,026,094 Y782H probably damaging Het
Mrpl52 T C 14: 54,427,229 S49P probably damaging Het
Olfr132 T A 17: 38,131,184 T3S possibly damaging Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Olfr477 A T 7: 107,990,385 T7S probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pcbp2 C T 15: 102,487,089 A141V probably damaging Het
Pcsk9 T A 4: 106,458,916 Y110F probably damaging Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Polq T A 16: 37,040,534 L506Q probably damaging Het
Prx C T 7: 27,517,604 P510L probably damaging Het
Ptpre T C 7: 135,653,943 F54L probably damaging Het
Rspry1 T G 8: 94,636,611 probably null Het
Tnfrsf11b A T 15: 54,259,866 L113Q probably damaging Het
Tnk1 C T 11: 69,853,585 G411S probably damaging Het
Tor3a A G 1: 156,656,510 L290S probably damaging Het
Tril T C 6: 53,817,985 T751A probably benign Het
Tubgcp6 C T 15: 89,108,612 V547I possibly damaging Het
Txnrd3 T C 6: 89,654,085 L121P probably benign Het
Vmn1r210 T A 13: 22,827,208 R303* probably null Het
Vmn2r38 T C 7: 9,097,765 M1V probably null Het
Other mutations in Atp10d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1350:Atp10d UTSW 5 72261126 splice site probably benign
R3500:Atp10d UTSW 5 72245723 missense probably damaging 1.00
R3522:Atp10d UTSW 5 72239157 missense probably benign 0.01
R3833:Atp10d UTSW 5 72239225 missense possibly damaging 0.95
R4376:Atp10d UTSW 5 72296975 missense probably damaging 1.00
R4377:Atp10d UTSW 5 72296975 missense probably damaging 1.00
R4755:Atp10d UTSW 5 72246166 missense probably benign 0.04
R4828:Atp10d UTSW 5 72239118 missense probably benign 0.18
R5224:Atp10d UTSW 5 72269326 missense probably benign 0.03
R5289:Atp10d UTSW 5 72255123 missense probably benign 0.27
R5636:Atp10d UTSW 5 72288219 missense probably damaging 1.00
R5640:Atp10d UTSW 5 72247209 missense probably damaging 1.00
R5681:Atp10d UTSW 5 72246946 critical splice donor site probably benign
R5760:Atp10d UTSW 5 72260937 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTACAATGTCATCACGTGTAGC -3'
(R):5'- CAAGCTGAGTTACTGGCCTG -3'

Sequencing Primer
(F):5'- TAGCGTCGTTTTCCCTGGTGAC -3'
(R):5'- ACTGGCCTGGGGGATTTCATC -3'
Posted On2016-11-09