Incidental Mutation 'R5653:Rspry1'
ID442112
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
MMRRC Submission 043299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R5653 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 94636611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably null
Transcript: ENSMUST00000060389
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154035
Predicted Effect probably null
Transcript: ENSMUST00000211983
Predicted Effect probably null
Transcript: ENSMUST00000212729
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,883,412 L663P probably damaging Het
Atp10d A T 5: 72,264,067 Q682L probably benign Het
Atp8b1 A G 18: 64,545,197 V876A probably damaging Het
Bard1 A T 1: 71,031,429 V632E probably benign Het
Baz1b A T 5: 135,209,097 E209V probably benign Het
Bmp1 T A 14: 70,490,094 Y683F probably benign Het
Cacnb1 A T 11: 98,009,279 probably null Het
Capza2 G A 6: 17,654,113 A55T probably damaging Het
Cc2d2a A G 5: 43,722,462 N1127S possibly damaging Het
Ccdc13 A G 9: 121,798,787 *255R probably null Het
Ddias G T 7: 92,858,729 N659K probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dnah9 T C 11: 65,849,980 T4127A probably damaging Het
Dnajc10 T A 2: 80,349,368 Y749N probably damaging Het
Dnm1l A G 16: 16,319,489 L422P probably damaging Het
Edil3 A T 13: 89,131,812 N203I probably damaging Het
Egfr C T 11: 16,911,617 A1132V probably benign Het
Entpd7 C T 19: 43,691,157 R50* probably null Het
Fam160a1 A T 3: 85,722,501 L40Q probably damaging Het
Fat2 T C 11: 55,310,316 D644G probably damaging Het
Galnt11 T A 5: 25,248,858 D27E probably damaging Het
Gm10801 T A 2: 98,664,051 F158I probably damaging Het
Gm37240 A G 3: 84,497,795 F234L probably damaging Het
Gtf2ird1 A T 5: 134,410,967 F136L probably damaging Het
Hspa1l T C 17: 34,977,420 V145A probably damaging Het
Ice2 A G 9: 69,428,380 T882A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat6b A G 14: 21,669,372 N1264S probably benign Het
Kcnq4 C A 4: 120,702,411 V531L probably benign Het
Kif9 A T 9: 110,524,931 K790N probably damaging Het
Lipe T A 7: 25,398,408 I37L probably benign Het
Lrrc43 A G 5: 123,499,580 D270G probably damaging Het
Mon2 A G 10: 123,026,094 Y782H probably damaging Het
Mrpl52 T C 14: 54,427,229 S49P probably damaging Het
Olfr132 T A 17: 38,131,184 T3S possibly damaging Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Olfr477 A T 7: 107,990,385 T7S probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pcbp2 C T 15: 102,487,089 A141V probably damaging Het
Pcsk9 T A 4: 106,458,916 Y110F probably damaging Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Polq T A 16: 37,040,534 L506Q probably damaging Het
Prx C T 7: 27,517,604 P510L probably damaging Het
Ptpre T C 7: 135,653,943 F54L probably damaging Het
Tnfrsf11b A T 15: 54,259,866 L113Q probably damaging Het
Tnk1 C T 11: 69,853,585 G411S probably damaging Het
Tor3a A G 1: 156,656,510 L290S probably damaging Het
Tril T C 6: 53,817,985 T751A probably benign Het
Tubgcp6 C T 15: 89,108,612 V547I possibly damaging Het
Txnrd3 T C 6: 89,654,085 L121P probably benign Het
Vmn1r210 T A 13: 22,827,208 R303* probably null Het
Vmn2r38 T C 7: 9,097,765 M1V probably null Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCATTGAGATTGCCAGACAG -3'
(R):5'- AAGGTGCCTGGGATACTTTTCTATTAG -3'

Sequencing Primer
(F):5'- CCAGACAGTAGCTACAGTTCTTTGG -3'
(R):5'- GCGCTTGTCTAATGAGCTGAAACC -3'
Posted On2016-11-09