Mutagenetix > Incidental Mutation

Incidental Mutation 'R5653:Rspry1'

442112

Institutional Source

Beutler Lab

Gene Symbol

Rspry1

Ensembl Gene

ENSMUSG00000050079

Gene Name

ring finger and SPRY domain containing 1

Synonyms

4930470D19Rik

MMRRC Submission

043299-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.456) question?

Stock #

R5653 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94601937-94660275 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 94636611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148724 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]

AlphaFold

Q8BVR6

Predicted Effect

probably null
Transcript: ENSMUST00000060389

SMART Domains

Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	30	39	N/A	INTRINSIC
low complexity region	74	95	N/A	INTRINSIC
SPRY	358	482	2.94e-26	SMART
RING	527	561	3.93e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154035

Predicted Effect

probably null
Transcript: ENSMUST00000211983

Predicted Effect

probably null
Transcript: ENSMUST00000212729

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	T	C	5: 35,883,412	L663P	probably damaging	Het
Atp10d	A	T	5: 72,264,067	Q682L	probably benign	Het
Atp8b1	A	G	18: 64,545,197	V876A	probably damaging	Het
Bard1	A	T	1: 71,031,429	V632E	probably benign	Het
Baz1b	A	T	5: 135,209,097	E209V	probably benign	Het
Bmp1	T	A	14: 70,490,094	Y683F	probably benign	Het
Cacnb1	A	T	11: 98,009,279		probably null	Het
Capza2	G	A	6: 17,654,113	A55T	probably damaging	Het
Cc2d2a	A	G	5: 43,722,462	N1127S	possibly damaging	Het
Ccdc13	A	G	9: 121,798,787	*255R	probably null	Het
Ddias	G	T	7: 92,858,729	N659K	probably damaging	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dnah9	T	C	11: 65,849,980	T4127A	probably damaging	Het
Dnajc10	T	A	2: 80,349,368	Y749N	probably damaging	Het
Dnm1l	A	G	16: 16,319,489	L422P	probably damaging	Het
Edil3	A	T	13: 89,131,812	N203I	probably damaging	Het
Egfr	C	T	11: 16,911,617	A1132V	probably benign	Het
Entpd7	C	T	19: 43,691,157	R50*	probably null	Het
Fam160a1	A	T	3: 85,722,501	L40Q	probably damaging	Het
Fat2	T	C	11: 55,310,316	D644G	probably damaging	Het
Galnt11	T	A	5: 25,248,858	D27E	probably damaging	Het
Gm10801	T	A	2: 98,664,051	F158I	probably damaging	Het
Gm37240	A	G	3: 84,497,795	F234L	probably damaging	Het
Gtf2ird1	A	T	5: 134,410,967	F136L	probably damaging	Het
Hspa1l	T	C	17: 34,977,420	V145A	probably damaging	Het
Ice2	A	G	9: 69,428,380	T882A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kat6b	A	G	14: 21,669,372	N1264S	probably benign	Het
Kcnq4	C	A	4: 120,702,411	V531L	probably benign	Het
Kif9	A	T	9: 110,524,931	K790N	probably damaging	Het
Lipe	T	A	7: 25,398,408	I37L	probably benign	Het
Lrrc43	A	G	5: 123,499,580	D270G	probably damaging	Het
Mon2	A	G	10: 123,026,094	Y782H	probably damaging	Het
Mrpl52	T	C	14: 54,427,229	S49P	probably damaging	Het
Olfr132	T	A	17: 38,131,184	T3S	possibly damaging	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr318	G	A	11: 58,720,251	H266Y	probably damaging	Het
Olfr477	A	T	7: 107,990,385	T7S	probably benign	Het
Park2	C	T	17: 11,237,649	A119V	probably damaging	Het
Pcbp2	C	T	15: 102,487,089	A141V	probably damaging	Het
Pcsk9	T	A	4: 106,458,916	Y110F	probably damaging	Het
Plxna4	A	G	6: 32,517,616	S22P	possibly damaging	Het
Polq	T	A	16: 37,040,534	L506Q	probably damaging	Het
Prx	C	T	7: 27,517,604	P510L	probably damaging	Het
Ptpre	T	C	7: 135,653,943	F54L	probably damaging	Het
Tnfrsf11b	A	T	15: 54,259,866	L113Q	probably damaging	Het
Tnk1	C	T	11: 69,853,585	G411S	probably damaging	Het
Tor3a	A	G	1: 156,656,510	L290S	probably damaging	Het
Tril	T	C	6: 53,817,985	T751A	probably benign	Het
Tubgcp6	C	T	15: 89,108,612	V547I	possibly damaging	Het
Txnrd3	T	C	6: 89,654,085	L121P	probably benign	Het
Vmn1r210	T	A	13: 22,827,208	R303*	probably null	Het
Vmn2r38	T	C	7: 9,097,765	M1V	probably null	Het

Other mutations in Rspry1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rspry1	APN	8	94622986	start codon destroyed	probably null	0.89
IGL00158:Rspry1	APN	8	94622980	intron	probably benign
IGL01141:Rspry1	APN	8	94649855	missense	probably benign	0.00
IGL01860:Rspry1	APN	8	94649816	missense	probably benign	0.00
IGL02174:Rspry1	APN	8	94633140	missense	possibly damaging	0.84
IGL02819:Rspry1	APN	8	94654256	missense	probably benign	0.42
IGL02926:Rspry1	APN	8	94649811	missense	probably damaging	1.00
IGL03366:Rspry1	APN	8	94650334	missense	probably benign	0.00
R0570:Rspry1	UTSW	8	94629792	missense	probably damaging	1.00
R1833:Rspry1	UTSW	8	94635488	missense	probably damaging	1.00
R1988:Rspry1	UTSW	8	94632054	critical splice acceptor site	probably null
R2444:Rspry1	UTSW	8	94623107	missense	probably damaging	1.00
R3623:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R3624:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R4275:Rspry1	UTSW	8	94649761	missense	probably benign	0.00
R4888:Rspry1	UTSW	8	94658789	missense	probably benign	0.19
R5026:Rspry1	UTSW	8	94650303	missense	probably damaging	1.00
R5310:Rspry1	UTSW	8	94623185	missense	probably benign
R5374:Rspry1	UTSW	8	94623008	missense	probably benign	0.00
R5374:Rspry1	UTSW	8	94654264	missense	probably benign	0.38
R5387:Rspry1	UTSW	8	94638286	missense	possibly damaging	0.95
R5517:Rspry1	UTSW	8	94636760	splice site	probably null
R5631:Rspry1	UTSW	8	94629078	start codon destroyed	possibly damaging	0.79
R6065:Rspry1	UTSW	8	94622987	start codon destroyed	probably null	0.98
R6220:Rspry1	UTSW	8	94658750	missense	probably damaging	1.00
R6276:Rspry1	UTSW	8	94623258	missense	probably damaging	1.00
R6821:Rspry1	UTSW	8	94635431	nonsense	probably null
R7390:Rspry1	UTSW	8	94623185	missense	probably benign
R7460:Rspry1	UTSW	8	94650335	missense	probably benign	0.00
R7644:Rspry1	UTSW	8	94658768	missense	probably benign	0.00
R7717:Rspry1	UTSW	8	94623122	missense	probably damaging	1.00
R7768:Rspry1	UTSW	8	94629841	missense	probably damaging	1.00
R7940:Rspry1	UTSW	8	94623007	missense	probably benign	0.22
R7978:Rspry1	UTSW	8	94623125	missense	probably damaging	0.98
R8087:Rspry1	UTSW	8	94654297	missense	probably benign	0.04
R8174:Rspry1	UTSW	8	94649822	missense	probably damaging	0.97
R8326:Rspry1	UTSW	8	94639589	missense	probably damaging	1.00
R8676:Rspry1	UTSW	8	94632119	missense	probably benign	0.01
R8715:Rspry1	UTSW	8	94623260	missense	probably damaging	0.98
R8869:Rspry1	UTSW	8	94633152	missense	probably damaging	0.97
R9253:Rspry1	UTSW	8	94622993	missense	probably damaging	1.00
R9281:Rspry1	UTSW	8	94636631	missense	probably damaging	1.00
R9699:Rspry1	UTSW	8	94654229	missense	probably benign	0.01
X0010:Rspry1	UTSW	8	94629801	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- GCATTGAGATTGCCAGACAG -3'
(R):5'- AAGGTGCCTGGGATACTTTTCTATTAG -3'

Sequencing Primer
(F):5'- CCAGACAGTAGCTACAGTTCTTTGG -3'
(R):5'- GCGCTTGTCTAATGAGCTGAAACC -3'

Posted On

2016-11-09