Incidental Mutation 'R5653:Ice2'
ID442113
Institutional Source Beutler Lab
Gene Symbol Ice2
Ensembl Gene ENSMUSG00000032235
Gene Nameinteractor of little elongation complex ELL subunit 2
SynonymsNarg2, B230343B06Rik
MMRRC Submission 043299-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R5653 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location69397906-69433122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69428380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 882 (T882A)
Ref Sequence ENSEMBL: ENSMUSP00000034761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034761]
Predicted Effect probably benign
Transcript: ENSMUST00000034761
AA Change: T882A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034761
Gene: ENSMUSG00000032235
AA Change: T882A

DomainStartEndE-ValueType
low complexity region 408 422 N/A INTRINSIC
low complexity region 434 473 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:NARG2_C 726 936 1.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147558
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,883,412 L663P probably damaging Het
Atp10d A T 5: 72,264,067 Q682L probably benign Het
Atp8b1 A G 18: 64,545,197 V876A probably damaging Het
Bard1 A T 1: 71,031,429 V632E probably benign Het
Baz1b A T 5: 135,209,097 E209V probably benign Het
Bmp1 T A 14: 70,490,094 Y683F probably benign Het
Cacnb1 A T 11: 98,009,279 probably null Het
Capza2 G A 6: 17,654,113 A55T probably damaging Het
Cc2d2a A G 5: 43,722,462 N1127S possibly damaging Het
Ccdc13 A G 9: 121,798,787 *255R probably null Het
Ddias G T 7: 92,858,729 N659K probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dnah9 T C 11: 65,849,980 T4127A probably damaging Het
Dnajc10 T A 2: 80,349,368 Y749N probably damaging Het
Dnm1l A G 16: 16,319,489 L422P probably damaging Het
Edil3 A T 13: 89,131,812 N203I probably damaging Het
Egfr C T 11: 16,911,617 A1132V probably benign Het
Entpd7 C T 19: 43,691,157 R50* probably null Het
Fam160a1 A T 3: 85,722,501 L40Q probably damaging Het
Fat2 T C 11: 55,310,316 D644G probably damaging Het
Galnt11 T A 5: 25,248,858 D27E probably damaging Het
Gm10801 T A 2: 98,664,051 F158I probably damaging Het
Gm37240 A G 3: 84,497,795 F234L probably damaging Het
Gtf2ird1 A T 5: 134,410,967 F136L probably damaging Het
Hspa1l T C 17: 34,977,420 V145A probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat6b A G 14: 21,669,372 N1264S probably benign Het
Kcnq4 C A 4: 120,702,411 V531L probably benign Het
Kif9 A T 9: 110,524,931 K790N probably damaging Het
Lipe T A 7: 25,398,408 I37L probably benign Het
Lrrc43 A G 5: 123,499,580 D270G probably damaging Het
Mon2 A G 10: 123,026,094 Y782H probably damaging Het
Mrpl52 T C 14: 54,427,229 S49P probably damaging Het
Olfr132 T A 17: 38,131,184 T3S possibly damaging Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Olfr477 A T 7: 107,990,385 T7S probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pcbp2 C T 15: 102,487,089 A141V probably damaging Het
Pcsk9 T A 4: 106,458,916 Y110F probably damaging Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Polq T A 16: 37,040,534 L506Q probably damaging Het
Prx C T 7: 27,517,604 P510L probably damaging Het
Ptpre T C 7: 135,653,943 F54L probably damaging Het
Rspry1 T G 8: 94,636,611 probably null Het
Tnfrsf11b A T 15: 54,259,866 L113Q probably damaging Het
Tnk1 C T 11: 69,853,585 G411S probably damaging Het
Tor3a A G 1: 156,656,510 L290S probably damaging Het
Tril T C 6: 53,817,985 T751A probably benign Het
Tubgcp6 C T 15: 89,108,612 V547I possibly damaging Het
Txnrd3 T C 6: 89,654,085 L121P probably benign Het
Vmn1r210 T A 13: 22,827,208 R303* probably null Het
Vmn2r38 T C 7: 9,097,765 M1V probably null Het
Other mutations in Ice2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ice2 APN 9 69416113 missense probably benign 0.04
IGL01626:Ice2 APN 9 69407332 missense probably benign 0.39
IGL03035:Ice2 APN 9 69425688 missense probably benign 0.06
R0227:Ice2 UTSW 9 69412228 missense probably benign 0.08
R1373:Ice2 UTSW 9 69407119 missense probably benign 0.01
R1381:Ice2 UTSW 9 69400527 missense probably damaging 1.00
R1599:Ice2 UTSW 9 69411442 missense probably null 0.01
R1778:Ice2 UTSW 9 69415648 missense probably benign 0.04
R1818:Ice2 UTSW 9 69432101 missense probably benign 0.00
R1829:Ice2 UTSW 9 69407353 missense probably damaging 0.99
R1876:Ice2 UTSW 9 69415575 missense possibly damaging 0.85
R1878:Ice2 UTSW 9 69428576 critical splice donor site probably null
R2026:Ice2 UTSW 9 69416325 missense probably benign 0.00
R2915:Ice2 UTSW 9 69410840 missense probably benign 0.19
R4097:Ice2 UTSW 9 69421671 missense possibly damaging 0.95
R4815:Ice2 UTSW 9 69407118 missense probably damaging 1.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R5066:Ice2 UTSW 9 69408291 missense probably benign 0.00
R5898:Ice2 UTSW 9 69408262 missense probably benign 0.08
R5951:Ice2 UTSW 9 69412369 missense possibly damaging 0.67
R6176:Ice2 UTSW 9 69417072 missense probably damaging 1.00
R6566:Ice2 UTSW 9 69416229 missense probably benign
R6632:Ice2 UTSW 9 69428452 missense probably benign 0.07
R7195:Ice2 UTSW 9 69428500 missense possibly damaging 0.91
R7272:Ice2 UTSW 9 69417083 missense possibly damaging 0.46
R7365:Ice2 UTSW 9 69400512 missense probably damaging 1.00
R7495:Ice2 UTSW 9 69416229 missense probably benign 0.01
R7535:Ice2 UTSW 9 69432078 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAATCTTTACTTTTGCTGGTCCTG -3'
(R):5'- TACCTTTGCTTGTGCTGCAG -3'

Sequencing Primer
(F):5'- TTACTTTTGCTGGTCCTGAAATAC -3'
(R):5'- CAGGGCGCAGTGGTTTAG -3'
Posted On2016-11-09