Incidental Mutation 'R5653:Bmp1'
ID 442129
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 043299-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5653 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70727534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 683 (Y683F)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: Y683F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y683F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226601
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 36,040,756 (GRCm39) L663P probably damaging Het
Atp10d A T 5: 72,421,410 (GRCm39) Q682L probably benign Het
Atp8b1 A G 18: 64,678,268 (GRCm39) V876A probably damaging Het
Bard1 A T 1: 71,070,588 (GRCm39) V632E probably benign Het
Baz1b A T 5: 135,237,951 (GRCm39) E209V probably benign Het
Cacnb1 A T 11: 97,900,105 (GRCm39) probably null Het
Capza2 G A 6: 17,654,112 (GRCm39) A55T probably damaging Het
Cc2d2a A G 5: 43,879,804 (GRCm39) N1127S possibly damaging Het
Ccdc13 A G 9: 121,627,853 (GRCm39) *255R probably null Het
Ddias G T 7: 92,507,937 (GRCm39) N659K probably damaging Het
Ddr1 C T 17: 35,997,400 (GRCm39) A531T probably benign Het
Dnah9 T C 11: 65,740,806 (GRCm39) T4127A probably damaging Het
Dnajc10 T A 2: 80,179,712 (GRCm39) Y749N probably damaging Het
Dnm1l A G 16: 16,137,353 (GRCm39) L422P probably damaging Het
Edil3 A T 13: 89,279,931 (GRCm39) N203I probably damaging Het
Egfr C T 11: 16,861,617 (GRCm39) A1132V probably benign Het
Entpd7 C T 19: 43,679,596 (GRCm39) R50* probably null Het
Fat2 T C 11: 55,201,142 (GRCm39) D644G probably damaging Het
Fhip1a A T 3: 85,629,808 (GRCm39) L40Q probably damaging Het
Galnt11 T A 5: 25,453,856 (GRCm39) D27E probably damaging Het
Gm10801 T A 2: 98,494,396 (GRCm39) F158I probably damaging Het
Gm37240 A G 3: 84,405,102 (GRCm39) F234L probably damaging Het
Gtf2ird1 A T 5: 134,439,821 (GRCm39) F136L probably damaging Het
Hspa1l T C 17: 35,196,396 (GRCm39) V145A probably damaging Het
Ice2 A G 9: 69,335,662 (GRCm39) T882A probably benign Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kat6b A G 14: 21,719,440 (GRCm39) N1264S probably benign Het
Kcnq4 C A 4: 120,559,608 (GRCm39) V531L probably benign Het
Kif9 A T 9: 110,353,999 (GRCm39) K790N probably damaging Het
Lipe T A 7: 25,097,833 (GRCm39) I37L probably benign Het
Lrrc43 A G 5: 123,637,643 (GRCm39) D270G probably damaging Het
Mon2 A G 10: 122,861,999 (GRCm39) Y782H probably damaging Het
Mrpl52 T C 14: 54,664,686 (GRCm39) S49P probably damaging Het
Or2ak5 G A 11: 58,611,077 (GRCm39) H266Y probably damaging Het
Or2h15 T A 17: 38,442,075 (GRCm39) T3S possibly damaging Het
Or5k14 A G 16: 58,692,847 (GRCm39) L222P probably damaging Het
Or5p56 A T 7: 107,589,592 (GRCm39) T7S probably benign Het
Pcbp2 C T 15: 102,395,524 (GRCm39) A141V probably damaging Het
Pcsk9 T A 4: 106,316,113 (GRCm39) Y110F probably damaging Het
Plxna4 A G 6: 32,494,551 (GRCm39) S22P possibly damaging Het
Polq T A 16: 36,860,896 (GRCm39) L506Q probably damaging Het
Prkn C T 17: 11,456,536 (GRCm39) A119V probably damaging Het
Prx C T 7: 27,217,029 (GRCm39) P510L probably damaging Het
Ptpre T C 7: 135,255,672 (GRCm39) F54L probably damaging Het
Rspry1 T G 8: 95,363,239 (GRCm39) probably null Het
Tnfrsf11b A T 15: 54,123,262 (GRCm39) L113Q probably damaging Het
Tnk1 C T 11: 69,744,411 (GRCm39) G411S probably damaging Het
Tor3a A G 1: 156,484,080 (GRCm39) L290S probably damaging Het
Tril T C 6: 53,794,970 (GRCm39) T751A probably benign Het
Tubgcp6 C T 15: 88,992,815 (GRCm39) V547I possibly damaging Het
Txnrd3 T C 6: 89,631,067 (GRCm39) L121P probably benign Het
Vmn1r210 T A 13: 23,011,378 (GRCm39) R303* probably null Het
Vmn2r38 T C 7: 9,100,764 (GRCm39) M1V probably null Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATTCAGATGCCCCAGGG -3'
(R):5'- CACAGCAGCGTTTTGTTGG -3'

Sequencing Primer
(F):5'- CTGTACTGATGGAGGATAATAAGTTG -3'
(R):5'- GCAGATGCTTAGCCTGACAC -3'
Posted On 2016-11-09