Mutagenetix > Incidental Mutations

Incidental Mutation 'R5653:Bmp1'

442129

Institutional Source

Beutler Lab

Gene Symbol

Bmp1

Ensembl Gene

ENSMUSG00000022098

Gene Name

bone morphogenetic protein 1

Synonyms

MMRRC Submission

043299-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5653 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70474558-70520234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70490094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 683 (Y683F)

Ref Sequence

ENSEMBL: ENSMUSP00000022693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]

AlphaFold

P98063

Predicted Effect

probably benign
Transcript: ENSMUST00000022693
AA Change: Y683F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y683F

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226601

Predicted Effect

probably benign
Transcript: ENSMUST00000226906

Predicted Effect

probably benign
Transcript: ENSMUST00000227944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228501

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	T	C	5: 35,883,412	L663P	probably damaging	Het
Atp10d	A	T	5: 72,264,067	Q682L	probably benign	Het
Atp8b1	A	G	18: 64,545,197	V876A	probably damaging	Het
Bard1	A	T	1: 71,031,429	V632E	probably benign	Het
Baz1b	A	T	5: 135,209,097	E209V	probably benign	Het
Cacnb1	A	T	11: 98,009,279		probably null	Het
Capza2	G	A	6: 17,654,113	A55T	probably damaging	Het
Cc2d2a	A	G	5: 43,722,462	N1127S	possibly damaging	Het
Ccdc13	A	G	9: 121,798,787	*255R	probably null	Het
Ddias	G	T	7: 92,858,729	N659K	probably damaging	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dnah9	T	C	11: 65,849,980	T4127A	probably damaging	Het
Dnajc10	T	A	2: 80,349,368	Y749N	probably damaging	Het
Dnm1l	A	G	16: 16,319,489	L422P	probably damaging	Het
Edil3	A	T	13: 89,131,812	N203I	probably damaging	Het
Egfr	C	T	11: 16,911,617	A1132V	probably benign	Het
Entpd7	C	T	19: 43,691,157	R50*	probably null	Het
Fam160a1	A	T	3: 85,722,501	L40Q	probably damaging	Het
Fat2	T	C	11: 55,310,316	D644G	probably damaging	Het
Galnt11	T	A	5: 25,248,858	D27E	probably damaging	Het
Gm10801	T	A	2: 98,664,051	F158I	probably damaging	Het
Gm37240	A	G	3: 84,497,795	F234L	probably damaging	Het
Gtf2ird1	A	T	5: 134,410,967	F136L	probably damaging	Het
Hspa1l	T	C	17: 34,977,420	V145A	probably damaging	Het
Ice2	A	G	9: 69,428,380	T882A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kat6b	A	G	14: 21,669,372	N1264S	probably benign	Het
Kcnq4	C	A	4: 120,702,411	V531L	probably benign	Het
Kif9	A	T	9: 110,524,931	K790N	probably damaging	Het
Lipe	T	A	7: 25,398,408	I37L	probably benign	Het
Lrrc43	A	G	5: 123,499,580	D270G	probably damaging	Het
Mon2	A	G	10: 123,026,094	Y782H	probably damaging	Het
Mrpl52	T	C	14: 54,427,229	S49P	probably damaging	Het
Olfr132	T	A	17: 38,131,184	T3S	possibly damaging	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr318	G	A	11: 58,720,251	H266Y	probably damaging	Het
Olfr477	A	T	7: 107,990,385	T7S	probably benign	Het
Park2	C	T	17: 11,237,649	A119V	probably damaging	Het
Pcbp2	C	T	15: 102,487,089	A141V	probably damaging	Het
Pcsk9	T	A	4: 106,458,916	Y110F	probably damaging	Het
Plxna4	A	G	6: 32,517,616	S22P	possibly damaging	Het
Polq	T	A	16: 37,040,534	L506Q	probably damaging	Het
Prx	C	T	7: 27,517,604	P510L	probably damaging	Het
Ptpre	T	C	7: 135,653,943	F54L	probably damaging	Het
Rspry1	T	G	8: 94,636,611		probably null	Het
Tnfrsf11b	A	T	15: 54,259,866	L113Q	probably damaging	Het
Tnk1	C	T	11: 69,853,585	G411S	probably damaging	Het
Tor3a	A	G	1: 156,656,510	L290S	probably damaging	Het
Tril	T	C	6: 53,817,985	T751A	probably benign	Het
Tubgcp6	C	T	15: 89,108,612	V547I	possibly damaging	Het
Txnrd3	T	C	6: 89,654,085	L121P	probably benign	Het
Vmn1r210	T	A	13: 22,827,208	R303*	probably null	Het
Vmn2r38	T	C	7: 9,097,765	M1V	probably null	Het

Other mutations in Bmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Bmp1	APN	14	70492461	missense	probably damaging	1.00
IGL02065:Bmp1	APN	14	70486220	missense	probably damaging	0.97
IGL02065:Bmp1	APN	14	70490107	missense	probably damaging	0.99
IGL02349:Bmp1	APN	14	70507549	missense	possibly damaging	0.61
IGL02486:Bmp1	APN	14	70504776	missense	possibly damaging	0.48
PIT4519001:Bmp1	UTSW	14	70490029	missense	possibly damaging	0.65
R0394:Bmp1	UTSW	14	70490034	missense	probably damaging	0.99
R1371:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R1604:Bmp1	UTSW	14	70508004	missense	possibly damaging	0.66
R1732:Bmp1	UTSW	14	70486265	missense	possibly damaging	0.67
R1834:Bmp1	UTSW	14	70508831	missense	possibly damaging	0.73
R2008:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R2197:Bmp1	UTSW	14	70486272	missense	possibly damaging	0.83
R3157:Bmp1	UTSW	14	70492107	missense	possibly damaging	0.63
R4397:Bmp1	UTSW	14	70490542	splice site	probably null
R4609:Bmp1	UTSW	14	70477966	missense	probably benign	0.00
R4613:Bmp1	UTSW	14	70508523	missense	probably damaging	1.00
R4675:Bmp1	UTSW	14	70492844	missense	probably damaging	0.99
R4796:Bmp1	UTSW	14	70492073	splice site	probably null
R4884:Bmp1	UTSW	14	70475215	missense	probably benign	0.01
R4905:Bmp1	UTSW	14	70491362	missense	probably benign	0.06
R5088:Bmp1	UTSW	14	70486219	missense	possibly damaging	0.84
R5225:Bmp1	UTSW	14	70480165	missense	probably damaging	0.97
R5271:Bmp1	UTSW	14	70508128	missense	probably benign	0.34
R5625:Bmp1	UTSW	14	70486166	missense	probably benign	0.19
R6155:Bmp1	UTSW	14	70508007	missense	probably damaging	1.00
R6295:Bmp1	UTSW	14	70491383	missense	possibly damaging	0.88
R6618:Bmp1	UTSW	14	70491368	missense	probably damaging	1.00
R6649:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6653:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6951:Bmp1	UTSW	14	70508858	missense	probably benign	0.26
R6983:Bmp1	UTSW	14	70508207	missense	probably damaging	0.96
R7207:Bmp1	UTSW	14	70479560	missense	possibly damaging	0.56
R7500:Bmp1	UTSW	14	70490122	missense	probably benign	0.44
R7716:Bmp1	UTSW	14	70477922	nonsense	probably null
R7749:Bmp1	UTSW	14	70492844	missense	probably damaging	1.00
R7763:Bmp1	UTSW	14	70492084	missense	probably damaging	1.00
R7834:Bmp1	UTSW	14	70508565	missense	probably damaging	1.00
R8232:Bmp1	UTSW	14	70519889	missense	probably damaging	0.97
R8490:Bmp1	UTSW	14	70490133	missense	possibly damaging	0.94
R8827:Bmp1	UTSW	14	70490642	missense	probably damaging	1.00
R8945:Bmp1	UTSW	14	70490190	missense	probably damaging	1.00
R9178:Bmp1	UTSW	14	70490173	missense	possibly damaging	0.78
R9228:Bmp1	UTSW	14	70519898	missense	probably benign
X0028:Bmp1	UTSW	14	70508537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATATTCAGATGCCCCAGGG -3'
(R):5'- CACAGCAGCGTTTTGTTGG -3'

Sequencing Primer
(F):5'- CTGTACTGATGGAGGATAATAAGTTG -3'
(R):5'- GCAGATGCTTAGCCTGACAC -3'

Posted On

2016-11-09