Incidental Mutation 'R5653:Tubgcp6'
ID442132
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
MMRRC Submission 043299-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5653 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89108612 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 547 (V547I)
Ref Sequence ENSEMBL: ENSMUSP00000040132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000109353]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041656
AA Change: V547I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: V547I

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
AA Change: V547I

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: V547I

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,883,412 L663P probably damaging Het
Atp10d A T 5: 72,264,067 Q682L probably benign Het
Atp8b1 A G 18: 64,545,197 V876A probably damaging Het
Bard1 A T 1: 71,031,429 V632E probably benign Het
Baz1b A T 5: 135,209,097 E209V probably benign Het
Bmp1 T A 14: 70,490,094 Y683F probably benign Het
Cacnb1 A T 11: 98,009,279 probably null Het
Capza2 G A 6: 17,654,113 A55T probably damaging Het
Cc2d2a A G 5: 43,722,462 N1127S possibly damaging Het
Ccdc13 A G 9: 121,798,787 *255R probably null Het
Ddias G T 7: 92,858,729 N659K probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dnah9 T C 11: 65,849,980 T4127A probably damaging Het
Dnajc10 T A 2: 80,349,368 Y749N probably damaging Het
Dnm1l A G 16: 16,319,489 L422P probably damaging Het
Edil3 A T 13: 89,131,812 N203I probably damaging Het
Egfr C T 11: 16,911,617 A1132V probably benign Het
Entpd7 C T 19: 43,691,157 R50* probably null Het
Fam160a1 A T 3: 85,722,501 L40Q probably damaging Het
Fat2 T C 11: 55,310,316 D644G probably damaging Het
Galnt11 T A 5: 25,248,858 D27E probably damaging Het
Gm10801 T A 2: 98,664,051 F158I probably damaging Het
Gm37240 A G 3: 84,497,795 F234L probably damaging Het
Gtf2ird1 A T 5: 134,410,967 F136L probably damaging Het
Hspa1l T C 17: 34,977,420 V145A probably damaging Het
Ice2 A G 9: 69,428,380 T882A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat6b A G 14: 21,669,372 N1264S probably benign Het
Kcnq4 C A 4: 120,702,411 V531L probably benign Het
Kif9 A T 9: 110,524,931 K790N probably damaging Het
Lipe T A 7: 25,398,408 I37L probably benign Het
Lrrc43 A G 5: 123,499,580 D270G probably damaging Het
Mon2 A G 10: 123,026,094 Y782H probably damaging Het
Mrpl52 T C 14: 54,427,229 S49P probably damaging Het
Olfr132 T A 17: 38,131,184 T3S possibly damaging Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Olfr477 A T 7: 107,990,385 T7S probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pcbp2 C T 15: 102,487,089 A141V probably damaging Het
Pcsk9 T A 4: 106,458,916 Y110F probably damaging Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Polq T A 16: 37,040,534 L506Q probably damaging Het
Prx C T 7: 27,517,604 P510L probably damaging Het
Ptpre T C 7: 135,653,943 F54L probably damaging Het
Rspry1 T G 8: 94,636,611 probably null Het
Tnfrsf11b A T 15: 54,259,866 L113Q probably damaging Het
Tnk1 C T 11: 69,853,585 G411S probably damaging Het
Tor3a A G 1: 156,656,510 L290S probably damaging Het
Tril T C 6: 53,817,985 T751A probably benign Het
Txnrd3 T C 6: 89,654,085 L121P probably benign Het
Vmn1r210 T A 13: 22,827,208 R303* probably null Het
Vmn2r38 T C 7: 9,097,765 M1V probably null Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R7996:Tubgcp6 UTSW 15 89109028 missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89122774 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCAGTTATAATGGCCCTGACC -3'
(R):5'- AGGTAGGAGATCCCACACAC -3'

Sequencing Primer
(F):5'- TCTCTGCCAGTGAAATGAGC -3'
(R):5'- ACCCATAGCTGGCAGTGTCTC -3'
Posted On2016-11-09