Mutagenetix > Incidental Mutation

Incidental Mutation 'R5653:Entpd7'

442141

Institutional Source

Beutler Lab

Gene Symbol

Entpd7

Ensembl Gene

ENSMUSG00000025192

Gene Name

ectonucleoside triphosphate diphosphohydrolase 7

Synonyms

1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2

MMRRC Submission

043299-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R5653 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43689672-43733697 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 43691157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 50 (R50*)

Ref Sequence

ENSEMBL: ENSMUSP00000079864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081079]

AlphaFold

Q3TCT4

Predicted Effect

probably null
Transcript: ENSMUST00000081079
AA Change: R50*

SMART Domains

Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: R50*

Domain	Start	End	E-Value	Type
transmembrane domain	30	52	N/A	INTRINSIC
Pfam:GDA1_CD39	75	534	3.6e-106	PFAM
transmembrane domain	550	572	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152786

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	T	C	5: 35,883,412	L663P	probably damaging	Het
Atp10d	A	T	5: 72,264,067	Q682L	probably benign	Het
Atp8b1	A	G	18: 64,545,197	V876A	probably damaging	Het
Bard1	A	T	1: 71,031,429	V632E	probably benign	Het
Baz1b	A	T	5: 135,209,097	E209V	probably benign	Het
Bmp1	T	A	14: 70,490,094	Y683F	probably benign	Het
Cacnb1	A	T	11: 98,009,279		probably null	Het
Capza2	G	A	6: 17,654,113	A55T	probably damaging	Het
Cc2d2a	A	G	5: 43,722,462	N1127S	possibly damaging	Het
Ccdc13	A	G	9: 121,798,787	*255R	probably null	Het
Ddias	G	T	7: 92,858,729	N659K	probably damaging	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dnah9	T	C	11: 65,849,980	T4127A	probably damaging	Het
Dnajc10	T	A	2: 80,349,368	Y749N	probably damaging	Het
Dnm1l	A	G	16: 16,319,489	L422P	probably damaging	Het
Edil3	A	T	13: 89,131,812	N203I	probably damaging	Het
Egfr	C	T	11: 16,911,617	A1132V	probably benign	Het
Fam160a1	A	T	3: 85,722,501	L40Q	probably damaging	Het
Fat2	T	C	11: 55,310,316	D644G	probably damaging	Het
Galnt11	T	A	5: 25,248,858	D27E	probably damaging	Het
Gm10801	T	A	2: 98,664,051	F158I	probably damaging	Het
Gm37240	A	G	3: 84,497,795	F234L	probably damaging	Het
Gtf2ird1	A	T	5: 134,410,967	F136L	probably damaging	Het
Hspa1l	T	C	17: 34,977,420	V145A	probably damaging	Het
Ice2	A	G	9: 69,428,380	T882A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kat6b	A	G	14: 21,669,372	N1264S	probably benign	Het
Kcnq4	C	A	4: 120,702,411	V531L	probably benign	Het
Kif9	A	T	9: 110,524,931	K790N	probably damaging	Het
Lipe	T	A	7: 25,398,408	I37L	probably benign	Het
Lrrc43	A	G	5: 123,499,580	D270G	probably damaging	Het
Mon2	A	G	10: 123,026,094	Y782H	probably damaging	Het
Mrpl52	T	C	14: 54,427,229	S49P	probably damaging	Het
Olfr132	T	A	17: 38,131,184	T3S	possibly damaging	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr318	G	A	11: 58,720,251	H266Y	probably damaging	Het
Olfr477	A	T	7: 107,990,385	T7S	probably benign	Het
Park2	C	T	17: 11,237,649	A119V	probably damaging	Het
Pcbp2	C	T	15: 102,487,089	A141V	probably damaging	Het
Pcsk9	T	A	4: 106,458,916	Y110F	probably damaging	Het
Plxna4	A	G	6: 32,517,616	S22P	possibly damaging	Het
Polq	T	A	16: 37,040,534	L506Q	probably damaging	Het
Prx	C	T	7: 27,517,604	P510L	probably damaging	Het
Ptpre	T	C	7: 135,653,943	F54L	probably damaging	Het
Rspry1	T	G	8: 94,636,611		probably null	Het
Tnfrsf11b	A	T	15: 54,259,866	L113Q	probably damaging	Het
Tnk1	C	T	11: 69,853,585	G411S	probably damaging	Het
Tor3a	A	G	1: 156,656,510	L290S	probably damaging	Het
Tril	T	C	6: 53,817,985	T751A	probably benign	Het
Tubgcp6	C	T	15: 89,108,612	V547I	possibly damaging	Het
Txnrd3	T	C	6: 89,654,085	L121P	probably benign	Het
Vmn1r210	T	A	13: 22,827,208	R303*	probably null	Het
Vmn2r38	T	C	7: 9,097,765	M1V	probably null	Het

Other mutations in Entpd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01431:Entpd7	APN	19	43729839	missense	probably benign	0.00
R0056:Entpd7	UTSW	19	43725294	missense	probably benign	0.09
R0118:Entpd7	UTSW	19	43704312	nonsense	probably null
R0639:Entpd7	UTSW	19	43691094	missense	probably benign	0.42
R1479:Entpd7	UTSW	19	43721840	missense	probably damaging	1.00
R1532:Entpd7	UTSW	19	43691077	missense	possibly damaging	0.76
R1647:Entpd7	UTSW	19	43721745	splice site	probably benign
R1689:Entpd7	UTSW	19	43725476	missense	probably damaging	0.96
R2230:Entpd7	UTSW	19	43721816	missense	probably benign	0.07
R2231:Entpd7	UTSW	19	43721816	missense	probably benign	0.07
R2422:Entpd7	UTSW	19	43728088	missense	possibly damaging	0.66
R3807:Entpd7	UTSW	19	43725540	critical splice donor site	probably null
R3914:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R3949:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4021:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4022:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4095:Entpd7	UTSW	19	43704201	missense	probably damaging	1.00
R4737:Entpd7	UTSW	19	43691195	nonsense	probably null
R5582:Entpd7	UTSW	19	43704994	missense	probably damaging	1.00
R5763:Entpd7	UTSW	19	43704266	missense	probably damaging	1.00
R6508:Entpd7	UTSW	19	43691086	missense	probably damaging	1.00
R7657:Entpd7	UTSW	19	43725467	missense	possibly damaging	0.67
R8013:Entpd7	UTSW	19	43728055	missense	probably benign	0.00
R8235:Entpd7	UTSW	19	43717545	missense	probably damaging	1.00
R8880:Entpd7	UTSW	19	43704407	splice site	probably benign
R9318:Entpd7	UTSW	19	43704270	missense	possibly damaging	0.88
R9564:Entpd7	UTSW	19	43717450	missense	probably benign	0.01
Z1176:Entpd7	UTSW	19	43725358	missense	probably benign	0.43
Z1177:Entpd7	UTSW	19	43725497	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTTCAGGGTGTTCATCTAG -3'
(R):5'- GTGAGGACATAACTTAGTGACATG -3'

Sequencing Primer
(F):5'- AGCGGTAATTTATGGAGAGATTTTAG -3'
(R):5'- CTTAGTGACATGATGCTTACTGAG -3'

Posted On

2016-11-09