Incidental Mutation 'R5654:Cyb5r4'
ID442179
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Namecytochrome b5 reductase 4
Synonymsb5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87022014-87077774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87047480 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 229 (S229I)
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
Predicted Effect probably damaging
Transcript: ENSMUST00000168529
AA Change: S229I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872
AA Change: S229I

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174724
SMART Domains Protein: ENSMUSP00000133556
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.2e-16 PFAM
Pfam:FAD_binding_6 284 391 1.7e-22 PFAM
Pfam:NAD_binding_1 402 509 3.9e-17 PFAM
Meta Mutation Damage Score 0.6388 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTAGTTAGCAGAAAGAGATATGG -3'
(R):5'- CACGAGTGTACTTTAAAATGAGTGT -3'

Sequencing Primer
(F):5'- TGGGAAAATGGAAGTAGTTAGGAAC -3'
(R):5'- TGGAACTCACCTTGTAGACCAGG -3'
Posted On2016-11-09