Incidental Mutation 'R5654:Btaf1'
ID442212
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
MMRRC Submission 043300-MU
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36983615 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 796 (N796I)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: N796I

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: N796I

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
R7888:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R7944:Btaf1 UTSW 19 36949165 missense probably benign
R8062:Btaf1 UTSW 19 36992465 missense probably benign 0.00
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGTGTAAAGCTGTTACCC -3'
(R):5'- TTTTCCAGGAAGATGTATTAACCGG -3'

Sequencing Primer
(F):5'- AAAGCTGTTACCCTAGCTGTG -3'
(R):5'- CCAGGAAGATGTATTAACCGGTTTTC -3'
Posted On2016-11-09