Incidental Mutation 'R5655:Lamc3'
ID442220
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Namelaminin gamma 3
Synonyms
MMRRC Submission 043301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31887291-31946539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31925717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1142 (R1142S)
Ref Sequence ENSEMBL: ENSMUSP00000118745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect probably benign
Transcript: ENSMUST00000028187
AA Change: R1142S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: R1142S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135995
Predicted Effect probably benign
Transcript: ENSMUST00000138325
AA Change: R1142S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: R1142S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cog4 A G 8: 110,863,307 Y368C probably damaging Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gabra1 A T 11: 42,182,923 probably null Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Ift140 C T 17: 25,045,064 L514F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Ranbp1 C T 16: 18,241,805 D127N probably damaging Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc27a2 T C 2: 126,578,939 L314P probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
St6galnac2 T C 11: 116,685,146 N160D probably damaging Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31900581 missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31918521 missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31914656 missense probably benign 0.07
IGL01086:Lamc3 APN 2 31898476 missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31912107 missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31898278 missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31887655 missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31914604 splice site probably benign
IGL02340:Lamc3 APN 2 31918457 missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31905965 missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31920662 missense probably benign 0.00
IGL02679:Lamc3 APN 2 31945398 missense probably benign 0.01
IGL02751:Lamc3 APN 2 31920704 missense probably benign 0.07
IGL02820:Lamc3 APN 2 31923022 missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31935725 splice site probably benign
IGL02926:Lamc3 APN 2 31935726 splice site probably benign
IGL03090:Lamc3 APN 2 31908698 splice site probably benign
IGL03258:Lamc3 APN 2 31887683 missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31922428 missense probably benign 0.07
R0137:Lamc3 UTSW 2 31908616 missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31915084 splice site probably benign
R0244:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31937968 missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31928802 missense probably benign 0.03
R1142:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31928847 missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31887411 missense probably benign
R1515:Lamc3 UTSW 2 31940751 missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31915996 missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31921781 missense probably null 0.01
R1707:Lamc3 UTSW 2 31912129 critical splice donor site probably null
R1714:Lamc3 UTSW 2 31940757 missense probably benign 0.02
R1838:Lamc3 UTSW 2 31925582 missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31940702 missense probably benign 0.02
R3177:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31924592 missense probably benign 0.01
R4065:Lamc3 UTSW 2 31945258 missense probably benign 0.00
R4089:Lamc3 UTSW 2 31920508 nonsense probably null
R4373:Lamc3 UTSW 2 31898232 missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31931952 missense probably benign
R4395:Lamc3 UTSW 2 31931952 missense probably benign
R4397:Lamc3 UTSW 2 31931952 missense probably benign
R4746:Lamc3 UTSW 2 31905614 missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31940736 missense probably benign 0.02
R4960:Lamc3 UTSW 2 31915954 missense probably benign 0.00
R5025:Lamc3 UTSW 2 31908669 missense probably benign 0.13
R5062:Lamc3 UTSW 2 31905667 missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31887344 start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31918596 missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31931985 missense probably benign
R5928:Lamc3 UTSW 2 31921709 missense probably benign 0.00
R6018:Lamc3 UTSW 2 31905712 missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31887401 missense probably benign
R6601:Lamc3 UTSW 2 31920532 missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31908689 missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31938069 missense probably benign
R7114:Lamc3 UTSW 2 31930645 missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31930702 missense probably benign 0.39
R7559:Lamc3 UTSW 2 31922368 missense probably benign 0.00
R7787:Lamc3 UTSW 2 31900539 missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31921763 missense probably benign
X0010:Lamc3 UTSW 2 31938012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGTGATCGCTGGGTCAC -3'
(R):5'- CAAGGTTTACAGCCGGCTAG -3'

Sequencing Primer
(F):5'- TCACTGGCTTCCCACAGAG -3'
(R):5'- AGAATGATGTCGATATTGTGCCTTTC -3'
Posted On2016-11-09