Incidental Mutation 'R5655:Atxn2'
ID 442239
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 043301-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R5655 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121885489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 232 (I232T)
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000225761]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051950
AA Change: I232T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: I232T

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160813
Predicted Effect probably benign
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195919
Predicted Effect possibly damaging
Transcript: ENSMUST00000225761
AA Change: I82T

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,796,746 (GRCm39) I99F probably benign Het
Acan G A 7: 78,749,791 (GRCm39) D1521N possibly damaging Het
Acap3 C T 4: 155,981,076 (GRCm39) T53I probably benign Het
Actr3b G T 5: 26,053,366 (GRCm39) V232F probably damaging Het
Adgrl1 G A 8: 84,665,230 (GRCm39) V1311M possibly damaging Het
Arhgap23 T C 11: 97,343,372 (GRCm39) probably null Het
Asns A C 6: 7,685,309 (GRCm39) M116R probably benign Het
Asprv1 A T 6: 86,605,464 (GRCm39) E103D probably benign Het
B020004C17Rik C T 14: 57,252,689 (GRCm39) probably benign Het
Bckdha A G 7: 25,329,789 (GRCm39) Y414H probably damaging Het
Bod1l G A 5: 41,974,387 (GRCm39) T2309M probably benign Het
Cacna2d1 T A 5: 16,507,333 (GRCm39) F361I probably damaging Het
Cdc45 C T 16: 18,626,029 (GRCm39) probably null Het
Cog4 A G 8: 111,589,939 (GRCm39) Y368C probably damaging Het
Cplx3 C T 9: 57,523,258 (GRCm39) V100M probably damaging Het
Cyp4a12b C G 4: 115,290,994 (GRCm39) H341D probably damaging Het
Ddx10 A T 9: 53,120,987 (GRCm39) probably null Het
Dnah12 A T 14: 26,431,424 (GRCm39) Y414F probably benign Het
Dync1h1 A G 12: 110,595,496 (GRCm39) K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 (GRCm39) D928E probably benign Het
Dzip1 T A 14: 119,124,644 (GRCm39) probably null Het
Fam8a1 T A 13: 46,827,814 (GRCm39) L334H probably damaging Het
Fgf14 T C 14: 124,429,828 (GRCm39) N36D probably benign Het
Fmnl3 A T 15: 99,219,743 (GRCm39) F668L probably damaging Het
Foxl2 C T 9: 98,838,048 (GRCm39) P112L probably damaging Het
Foxp2 T G 6: 15,197,112 (GRCm39) H51Q probably damaging Het
Frem3 A T 8: 81,339,323 (GRCm39) T539S probably benign Het
Ftcd G T 10: 76,423,937 (GRCm39) G493C probably damaging Het
Gab2 A G 7: 96,948,099 (GRCm39) S230G probably benign Het
Gabra1 A T 11: 42,073,750 (GRCm39) probably null Het
Gm14496 A T 2: 181,637,975 (GRCm39) I350L probably benign Het
Idh2 A C 7: 79,747,996 (GRCm39) C235G probably damaging Het
Ift140 C T 17: 25,264,038 (GRCm39) L514F probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Lamc3 C A 2: 31,815,729 (GRCm39) R1142S probably benign Het
Lmod2 A T 6: 24,603,853 (GRCm39) H276L possibly damaging Het
Lrrc37a T A 11: 103,389,381 (GRCm39) I2015L probably benign Het
Mcf2l A G 8: 13,060,444 (GRCm39) E764G probably damaging Het
Mcph1 G A 8: 18,838,326 (GRCm39) M749I probably benign Het
Msh2 C T 17: 88,026,871 (GRCm39) A789V possibly damaging Het
Ndufa2 T C 18: 36,877,519 (GRCm39) I19V probably benign Het
Neurod4 T A 10: 130,107,002 (GRCm39) K91* probably null Het
Nos1 G T 5: 118,061,322 (GRCm39) G883C probably damaging Het
Npdc1 A T 2: 25,297,692 (GRCm39) H121L possibly damaging Het
Or2ak5 G A 11: 58,611,077 (GRCm39) H266Y probably damaging Het
Or3a10 A C 11: 73,935,160 (GRCm39) Y313* probably null Het
Orc1 A G 4: 108,450,636 (GRCm39) I123V probably benign Het
P2ry13 C T 3: 59,117,260 (GRCm39) V173M possibly damaging Het
Pigk T A 3: 152,445,858 (GRCm39) N156K probably damaging Het
Pik3ap1 A T 19: 41,286,680 (GRCm39) F569Y possibly damaging Het
Pla2g4c T A 7: 13,063,889 (GRCm39) probably null Het
Plk3 A G 4: 116,988,677 (GRCm39) L324P probably damaging Het
Pom121 A G 5: 135,421,171 (GRCm39) S260P unknown Het
Prkn C T 17: 11,456,536 (GRCm39) A119V probably damaging Het
Prrt2 G A 7: 126,618,574 (GRCm39) A297V probably damaging Het
Prss47 A T 13: 65,192,857 (GRCm39) V308E probably damaging Het
Ptbp2 T C 3: 119,517,806 (GRCm39) I139V probably benign Het
Ptprz1 A T 6: 22,999,772 (GRCm39) M621L probably benign Het
Rab6a G A 7: 100,257,501 (GRCm39) probably null Het
Ranbp1 C T 16: 18,059,669 (GRCm39) D127N probably damaging Het
Rnpepl1 G T 1: 92,847,032 (GRCm39) R272L probably damaging Het
Slc27a2 T C 2: 126,420,859 (GRCm39) L314P probably damaging Het
Slc6a5 A T 7: 49,606,218 (GRCm39) M709L probably benign Het
Smarcc1 A T 9: 109,986,412 (GRCm39) S238C probably null Het
Snx29 C T 16: 11,573,185 (GRCm39) L476F probably damaging Het
Sorbs2 T C 8: 46,194,618 (GRCm39) probably null Het
St6galnac2 T C 11: 116,575,972 (GRCm39) N160D probably damaging Het
Thsd7b A G 1: 129,556,671 (GRCm39) probably null Het
Trpc4ap G A 2: 155,495,547 (GRCm39) T306I possibly damaging Het
Ubr5 T G 15: 38,015,337 (GRCm39) Y891S probably damaging Het
Vmn1r220 A G 13: 23,368,298 (GRCm39) F133L probably benign Het
Vmn1r56 T A 7: 5,198,700 (GRCm39) I306F possibly damaging Het
Vmn1r67 T C 7: 10,181,315 (GRCm39) V193A probably benign Het
Yipf1 T A 4: 107,202,354 (GRCm39) V239E probably damaging Het
Zfp7 G T 15: 76,775,629 (GRCm39) C557F probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCTTTTCTCGTAGGGAAAC -3'
(R):5'- TAAAGCTACACACTTCTGTCCC -3'

Sequencing Primer
(F):5'- CCTTTTCTCGTAGGGAAACAAAATG -3'
(R):5'- TCTGTCCCCACTACCATTAGATAAC -3'
Posted On 2016-11-09