Incidental Mutation 'R5655:Cog4'
ID442264
Institutional Source Beutler Lab
Gene Symbol Cog4
Ensembl Gene ENSMUSG00000031753
Gene Namecomponent of oligomeric golgi complex 4
SynonymsD8Ertd515e
MMRRC Submission 043301-MU
Accession Numbers

Genbank: NM_133973; MGI: 2142808  

Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110846600-110882227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110863307 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 368 (Y368C)
Ref Sequence ENSEMBL: ENSMUSP00000133297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000165867] [ENSMUST00000172542] [ENSMUST00000174398] [ENSMUST00000174679]
Predicted Effect probably damaging
Transcript: ENSMUST00000034203
AA Change: Y369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: Y369C

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165867
AA Change: Y296C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: Y296C

DomainStartEndE-ValueType
Blast:Cog4 8 105 6e-54 BLAST
Cog4 115 425 1.81e-140 SMART
PDB:3HR0|B 452 712 1e-174 PDB
Blast:DIL 621 702 6e-38 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172542
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133283
Gene: ENSMUSG00000031753
AA Change: Y31C

DomainStartEndE-ValueType
Pfam:COG4 1 156 6.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173794
Predicted Effect probably damaging
Transcript: ENSMUST00000174398
AA Change: Y368C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: Y368C

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
coiled coil region 33 76 N/A INTRINSIC
Blast:Cog4 80 177 9e-54 BLAST
Cog4 187 497 1.81e-140 SMART
PDB:3HR0|B 524 763 1e-153 PDB
Blast:DIL 672 753 7e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174679
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180679
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gabra1 A T 11: 42,182,923 probably null Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Ift140 C T 17: 25,045,064 L514F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lamc3 C A 2: 31,925,717 R1142S probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Ranbp1 C T 16: 18,241,805 D127N probably damaging Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc27a2 T C 2: 126,578,939 L314P probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
St6galnac2 T C 11: 116,685,146 N160D probably damaging Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in Cog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cog4 APN 8 110866085 missense probably benign 0.44
IGL01631:Cog4 APN 8 110881840 missense probably damaging 1.00
IGL01756:Cog4 APN 8 110853759 nonsense probably null
IGL02850:Cog4 APN 8 110866589 missense possibly damaging 0.46
IGL02932:Cog4 APN 8 110852433 missense probably benign 0.16
IGL03232:Cog4 APN 8 110880682 splice site probably null
Deminimis UTSW 8 110881480 missense probably damaging 0.98
PIT4362001:Cog4 UTSW 8 110866672 missense probably damaging 1.00
R0350:Cog4 UTSW 8 110853696 missense possibly damaging 0.73
R1368:Cog4 UTSW 8 110858525 unclassified probably benign
R1531:Cog4 UTSW 8 110879721 missense probably benign 0.30
R2110:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2112:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2867:Cog4 UTSW 8 110866659 intron probably benign
R4239:Cog4 UTSW 8 110858612 missense probably damaging 0.98
R4867:Cog4 UTSW 8 110866610 missense probably damaging 1.00
R4967:Cog4 UTSW 8 110852283 splice site probably null
R5124:Cog4 UTSW 8 110847193 missense probably damaging 1.00
R6024:Cog4 UTSW 8 110881480 missense probably damaging 0.98
R6347:Cog4 UTSW 8 110880643 missense probably damaging 1.00
R6475:Cog4 UTSW 8 110880894 missense possibly damaging 0.74
R6526:Cog4 UTSW 8 110881786 missense probably damaging 1.00
R6542:Cog4 UTSW 8 110851362 missense probably damaging 1.00
R6545:Cog4 UTSW 8 110880945 missense probably damaging 1.00
R7248:Cog4 UTSW 8 110882202 missense unknown
R7292:Cog4 UTSW 8 110881828 missense probably damaging 1.00
R7356:Cog4 UTSW 8 110849866 critical splice acceptor site probably null
R7440:Cog4 UTSW 8 110879706 missense probably benign 0.06
R7751:Cog4 UTSW 8 110880968 missense probably damaging 1.00
Z1177:Cog4 UTSW 8 110879015 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCTGTGTCTGTAACAAGCAAG -3'
(R):5'- CCCAATAGGAACCAATTTGTCCAG -3'

Sequencing Primer
(F):5'- TCTGTAACAAGCAAGGCGGC -3'
(R):5'- CAGAGAGGTTTCCGTAGTAAGATCTC -3'
Posted On2016-11-09