Incidental Mutation 'R5655:Gabra1'
ID442272
Institutional Source Beutler Lab
Gene Symbol Gabra1
Ensembl Gene ENSMUSG00000010803
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 1
SynonymsGabra-1, GABAAR alpha1, GABAA alpha 1
MMRRC Submission 043301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location42130939-42182930 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 42182923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020707] [ENSMUST00000132971] [ENSMUST00000153147] [ENSMUST00000205546] [ENSMUST00000206085] [ENSMUST00000206105] [ENSMUST00000207274]
Predicted Effect probably benign
Transcript: ENSMUST00000020707
SMART Domains Protein: ENSMUSP00000020707
Gene: ENSMUSG00000010803

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 41 249 1.5e-52 PFAM
Pfam:Neur_chan_memb 256 347 8.6e-33 PFAM
low complexity region 395 411 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132971
AA Change: C2*
SMART Domains Protein: ENSMUSP00000126611
Gene: ENSMUSG00000010803
AA Change: C2*

DomainStartEndE-ValueType
low complexity region 50 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153147
SMART Domains Protein: ENSMUSP00000129056
Gene: ENSMUSG00000010803

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 46 84 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169305
Predicted Effect probably benign
Transcript: ENSMUST00000205546
Predicted Effect probably null
Transcript: ENSMUST00000206085
Predicted Effect probably benign
Transcript: ENSMUST00000206105
Predicted Effect probably benign
Transcript: ENSMUST00000207274
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knockout alleles or ones with various nucleotide substitutions exhibit altered life span, abnormal response to benzodiazepines and imidazopyridines, abnormal behaviors and abnormal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cog4 A G 8: 110,863,307 Y368C probably damaging Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Ift140 C T 17: 25,045,064 L514F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lamc3 C A 2: 31,925,717 R1142S probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Ranbp1 C T 16: 18,241,805 D127N probably damaging Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc27a2 T C 2: 126,578,939 L314P probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
St6galnac2 T C 11: 116,685,146 N160D probably damaging Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in Gabra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Gabra1 APN 11 42133626 missense probably benign 0.06
IGL01645:Gabra1 APN 11 42135562 missense probably damaging 1.00
IGL01893:Gabra1 APN 11 42133759 missense possibly damaging 0.80
IGL02114:Gabra1 APN 11 42135575 missense probably damaging 1.00
IGL02378:Gabra1 APN 11 42140255 missense probably damaging 1.00
IGL03402:Gabra1 APN 11 42133518 missense probably damaging 0.96
R0546:Gabra1 UTSW 11 42162601 missense probably damaging 0.96
R1495:Gabra1 UTSW 11 42154944 missense probably damaging 1.00
R1538:Gabra1 UTSW 11 42140350 missense probably benign 0.19
R1850:Gabra1 UTSW 11 42179576 missense probably benign
R1989:Gabra1 UTSW 11 42155015 missense probably damaging 1.00
R2061:Gabra1 UTSW 11 42133798 unclassified probably benign
R3758:Gabra1 UTSW 11 42175936 missense probably benign 0.25
R4781:Gabra1 UTSW 11 42133661 missense probably damaging 0.98
R4788:Gabra1 UTSW 11 42147153 missense probably damaging 1.00
R5215:Gabra1 UTSW 11 42154828 missense probably damaging 1.00
R5306:Gabra1 UTSW 11 42133552 missense probably benign 0.00
R5789:Gabra1 UTSW 11 42182915 unclassified probably benign
R6273:Gabra1 UTSW 11 42140311 missense probably damaging 0.99
R6289:Gabra1 UTSW 11 42155019 missense probably damaging 0.97
R6298:Gabra1 UTSW 11 42182378 unclassified probably benign
R6475:Gabra1 UTSW 11 42162555 missense probably benign 0.08
R6552:Gabra1 UTSW 11 42147099 missense probably damaging 0.99
R7338:Gabra1 UTSW 11 42182294 missense unknown
R7405:Gabra1 UTSW 11 42155023 missense probably damaging 1.00
R7515:Gabra1 UTSW 11 42154833 missense possibly damaging 0.95
R7725:Gabra1 UTSW 11 42135443 missense possibly damaging 0.94
R7727:Gabra1 UTSW 11 42133591 missense probably damaging 1.00
X0066:Gabra1 UTSW 11 42133738 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCATACTCTTCTAAGGTGTGCTC -3'
(R):5'- TCAGAGTTAAGGGAGTCTGTGC -3'

Sequencing Primer
(F):5'- CTCTTCTAAGGTGTGCTCATTAAAGC -3'
(R):5'- GCTTTTTCAGGACAACGCACG -3'
Posted On2016-11-09