Incidental Mutation 'R5655:Ranbp1'
ID442294
Institutional Source Beutler Lab
Gene Symbol Ranbp1
Ensembl Gene ENSMUSG00000005732
Gene NameRAN binding protein 1
SynonymsHtf9a
MMRRC Submission 043301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18239784-18248732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18241805 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 127 (D127N)
Ref Sequence ENSEMBL: ENSMUSP00000111309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052325] [ENSMUST00000115645]
Predicted Effect probably damaging
Transcript: ENSMUST00000052325
AA Change: D77N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732
AA Change: D77N

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115645
AA Change: D127N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732
AA Change: D127N

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134035
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, decreased body weight, impaired spermatogenesis, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cog4 A G 8: 110,863,307 Y368C probably damaging Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gabra1 A T 11: 42,182,923 probably null Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Ift140 C T 17: 25,045,064 L514F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lamc3 C A 2: 31,925,717 R1142S probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc27a2 T C 2: 126,578,939 L314P probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
St6galnac2 T C 11: 116,685,146 N160D probably damaging Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in Ranbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Ranbp1 APN 16 18247281 unclassified probably benign
R0189:Ranbp1 UTSW 16 18241743 critical splice donor site probably null
R0764:Ranbp1 UTSW 16 18240158 nonsense probably null
R3276:Ranbp1 UTSW 16 18247429 unclassified probably benign
R4381:Ranbp1 UTSW 16 18247344 missense probably damaging 1.00
R4620:Ranbp1 UTSW 16 18240104 unclassified probably benign
R5127:Ranbp1 UTSW 16 18247287 critical splice donor site probably null
R5965:Ranbp1 UTSW 16 18245228 missense probably damaging 0.97
R7080:Ranbp1 UTSW 16 18245233 missense possibly damaging 0.51
R7900:Ranbp1 UTSW 16 18245297 missense probably damaging 0.97
R7983:Ranbp1 UTSW 16 18245297 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCACACACCTGATGGGAG -3'
(R):5'- GTAGTCAGGTACAACAGCCTG -3'

Sequencing Primer
(F):5'- CACACCTGATGGGAGTCAACTG -3'
(R):5'- CAGCCTGGATCTCAGATTTTAGAC -3'
Posted On2016-11-09