Incidental Mutation 'R5655:Ift140'
ID442296
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
MMRRC Submission 043301-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5655 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25045064 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 514 (L514F)
Ref Sequence ENSEMBL: ENSMUSP00000116163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: L514F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: L514F

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000137386
AA Change: L514F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: L514F

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,648,880 I99F probably benign Het
Acan G A 7: 79,100,043 D1521N possibly damaging Het
Acap3 C T 4: 155,896,619 T53I probably benign Het
Actr3b G T 5: 25,848,368 V232F probably damaging Het
Adgrl1 G A 8: 83,938,601 V1311M possibly damaging Het
Arhgap23 T C 11: 97,452,546 probably null Het
Asns A C 6: 7,685,309 M116R probably benign Het
Asprv1 A T 6: 86,628,482 E103D probably benign Het
Atxn2 T C 5: 121,747,426 I232T probably damaging Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Bckdha A G 7: 25,630,364 Y414H probably damaging Het
Bod1l G A 5: 41,817,044 T2309M probably benign Het
Cacna2d1 T A 5: 16,302,335 F361I probably damaging Het
Cdc45 C T 16: 18,807,279 probably null Het
Cog4 A G 8: 110,863,307 Y368C probably damaging Het
Cyp4a12b C G 4: 115,433,797 H341D probably damaging Het
Ddx10 A T 9: 53,209,687 probably null Het
Dnah12 A T 14: 26,710,269 Y414F probably benign Het
Dync1h1 A G 12: 110,629,062 K1445R probably benign Het
Dync2h1 A C 9: 7,148,659 D928E probably benign Het
Dzip1 T A 14: 118,887,232 probably null Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fgf14 T C 14: 124,192,416 N36D probably benign Het
Fmnl3 A T 15: 99,321,862 F668L probably damaging Het
Foxl2 C T 9: 98,955,995 P112L probably damaging Het
Foxp2 T G 6: 15,197,113 H51Q probably damaging Het
Frem3 A T 8: 80,612,694 T539S probably benign Het
Ftcd G T 10: 76,588,103 G493C probably damaging Het
Gab2 A G 7: 97,298,892 S230G probably benign Het
Gabra1 A T 11: 42,182,923 probably null Het
Gm14496 A T 2: 181,996,182 I350L probably benign Het
Idh2 A C 7: 80,098,248 C235G probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lamc3 C A 2: 31,925,717 R1142S probably benign Het
Lman1l C T 9: 57,615,975 V100M probably damaging Het
Lmod2 A T 6: 24,603,854 H276L possibly damaging Het
Lrrc37a T A 11: 103,498,555 I2015L probably benign Het
Mcf2l A G 8: 13,010,444 E764G probably damaging Het
Mcph1 G A 8: 18,788,310 M749I probably benign Het
Msh2 C T 17: 87,719,443 A789V possibly damaging Het
Ndufa2 T C 18: 36,744,466 I19V probably benign Het
Neurod4 T A 10: 130,271,133 K91* probably null Het
Nos1 G T 5: 117,923,257 G883C probably damaging Het
Npdc1 A T 2: 25,407,680 H121L possibly damaging Het
Olfr139 A C 11: 74,044,334 Y313* probably null Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Orc1 A G 4: 108,593,439 I123V probably benign Het
P2ry13 C T 3: 59,209,839 V173M possibly damaging Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pigk T A 3: 152,740,221 N156K probably damaging Het
Pik3ap1 A T 19: 41,298,241 F569Y possibly damaging Het
Pla2g4c T A 7: 13,329,964 probably null Het
Plk3 A G 4: 117,131,480 L324P probably damaging Het
Pom121 A G 5: 135,392,317 S260P unknown Het
Prrt2 G A 7: 127,019,402 A297V probably damaging Het
Prss47 A T 13: 65,045,043 V308E probably damaging Het
Ptbp2 T C 3: 119,724,157 I139V probably benign Het
Ptprz1 A T 6: 22,999,773 M621L probably benign Het
Rab6a G A 7: 100,608,294 probably null Het
Ranbp1 C T 16: 18,241,805 D127N probably damaging Het
Rnpepl1 G T 1: 92,919,310 R272L probably damaging Het
Slc27a2 T C 2: 126,578,939 L314P probably damaging Het
Slc6a5 A T 7: 49,956,470 M709L probably benign Het
Smarcc1 A T 9: 110,157,344 S238C probably null Het
Snx29 C T 16: 11,755,321 L476F probably damaging Het
Sorbs2 T C 8: 45,741,581 probably null Het
St6galnac2 T C 11: 116,685,146 N160D probably damaging Het
Thsd7b A G 1: 129,628,934 probably null Het
Trpc4ap G A 2: 155,653,627 T306I possibly damaging Het
Ubr5 T G 15: 38,015,093 Y891S probably damaging Het
Vmn1r220 A G 13: 23,184,128 F133L probably benign Het
Vmn1r56 T A 7: 5,195,701 I306F possibly damaging Het
Vmn1r67 T C 7: 10,447,388 V193A probably benign Het
Yipf1 T A 4: 107,345,157 V239E probably damaging Het
Zfp7 G T 15: 76,891,429 C557F probably damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACCTGTGCATCTTTGATCC -3'
(R):5'- CCTGTCTACTAAATTGCCCCATAAC -3'

Sequencing Primer
(F):5'- TCACCGAGACTGTGCAGAAG -3'
(R):5'- CTAAATCTGTCCCTGCAAC -3'
Posted On2016-11-09