Incidental Mutation 'R5656:Cpa6'
ID 442300
Institutional Source Beutler Lab
Gene Symbol Cpa6
Ensembl Gene ENSMUSG00000042501
Gene Name carboxypeptidase A6
Synonyms 9030616D13Rik
MMRRC Submission 043302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R5656 (G1)
Quality Score 205
Status Not validated
Chromosome 1
Chromosomal Location 10324720-10719945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10329514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 363 (H363L)
Ref Sequence ENSEMBL: ENSMUSP00000035435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035577] [ENSMUST00000153695]
AlphaFold Q5U901
Predicted Effect probably benign
Transcript: ENSMUST00000035577
AA Change: H363L

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000035435
Gene: ENSMUSG00000042501
AA Change: H363L

DomainStartEndE-ValueType
Pfam:Propep_M14 43 119 3.1e-17 PFAM
Zn_pept 139 421 2.19e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153695
SMART Domains Protein: ENSMUSP00000118341
Gene: ENSMUSG00000042501

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1kwma2 31 64 2e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the metallocarboxypeptidase family of proteins that catalyze the release of a C-terminal amino acid from the target protein. The encoded preproprotein undergoes proteolytic cleavage to yield the mature form which is thought to play a role in cell migration. In humans, this protein regulates neuropeptides in the brain and mutations in this gene are associated with a recessive familial form of febrile seizures and with temporal lobe epilepsy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Cpa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Cpa6 APN 1 10483994 missense probably damaging 1.00
IGL00933:Cpa6 APN 1 10337370 missense probably benign 0.03
IGL01710:Cpa6 APN 1 10325272 missense probably damaging 0.99
IGL02211:Cpa6 APN 1 10595636 missense possibly damaging 0.83
IGL02504:Cpa6 APN 1 10488919 missense probably benign 0.19
R0487:Cpa6 UTSW 1 10409262 missense possibly damaging 0.77
R1260:Cpa6 UTSW 1 10325319 splice site probably null
R2154:Cpa6 UTSW 1 10337322 missense probably damaging 1.00
R4705:Cpa6 UTSW 1 10481058 missense probably benign 0.03
R4788:Cpa6 UTSW 1 10408277 missense possibly damaging 0.95
R4872:Cpa6 UTSW 1 10595618 critical splice donor site probably null
R4941:Cpa6 UTSW 1 10409337 missense probably benign 0.25
R5969:Cpa6 UTSW 1 10488883 missense probably benign 0.15
R6019:Cpa6 UTSW 1 10595643 missense possibly damaging 0.88
R6322:Cpa6 UTSW 1 10477121 missense possibly damaging 0.77
R6958:Cpa6 UTSW 1 10595688 missense probably damaging 1.00
R7154:Cpa6 UTSW 1 10337469 missense possibly damaging 0.71
R7274:Cpa6 UTSW 1 10409299 missense probably damaging 1.00
R8140:Cpa6 UTSW 1 10325294 missense probably damaging 1.00
R8559:Cpa6 UTSW 1 10408349 nonsense probably null
R9042:Cpa6 UTSW 1 10337290 missense probably benign 0.05
R9297:Cpa6 UTSW 1 10484048 missense possibly damaging 0.95
R9355:Cpa6 UTSW 1 10409295 missense probably benign 0.09
R9498:Cpa6 UTSW 1 10409321 missense possibly damaging 0.73
Z1177:Cpa6 UTSW 1 10329559 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGCGCTGGTTTAAATCGG -3'
(R):5'- CCGTTAACTTATGAGCCATCTTTG -3'

Sequencing Primer
(F):5'- CTGTCACGCTGTGGGAAACTAAAC -3'
(R):5'- GTTCTCTCTGTTGACATGACCAC -3'
Posted On 2016-11-09